Aligned Myoglobin Sequences

DNA sequencing gel Forward reaction DNA sequence (e value: 5e-44) GCCGTTGTTGAGTCGCAACAAAAAGCCCCCACCTTTCGGTGGGGGCTTTCCGATTCAACTGACGCTGAATCTTTTGGAGACTTCAGCCTCAGCCGATGGCG Reverse reaction DNA sequence (e value: 5e-44) GGCATCCGTGAGCCCGTCGCTGGCTCCCTGATCTACGGCAACAACATCATCTCCGGTGCTGTTGTGCCCTCCTCGAACGCCATCGGCCTTCACTTCTATCC The sequenced gene belongs to the psbA multigene family and codes for the D1 protein of photosystem II (PSII) in cyanobacteria such as Synechococcus WH7803. The D1 protein forms the core of the PSII’s reaction centre … Read More»

Southern Blot Technique to Detect the Ultrabithorax Gene

Using the Southern Blot Technique to Detect the Ultrabithorax gene in the Genomic DNA of the Drosophila melanogaster and the pET19 – Ubx plasmid Post Digestion by BamHI, NdeI, and BanII Restriction Enzymes Abstract: The Southern blot technique is used to detect targeted DNA sequences in DNA containing samples. In order to run the sample on an agarose gel … Read More»

The Human Spleen: Functions and Importance

The Human Spleen Description   The spleen is an organ system located in the upper far left part of the abdomen, to the left of the stomach. I chose to discuss this organ because it is often neglected as essential and I wanted to know how it impacts one’s health. This organ fluctuates in size … Read More»

Cerebral Infarction of the Uygur and Han Ethnic Groups

Research Article   The Difference of the Polymorphism of RS4360791 Loci of ALOX5AP Gene between Cerebral Infarction of the Uygur andHan Ethnic Groups InXinjiang 1.       Abstract Objective:To explore the difference of the polymorphism of RS4360791 loci of ALOX5AP gene between cerebral infarction of the Uygur and Han ethnic groups in Xinjiang Province, China. Methods:This is … Read More»

Handroanthus impetiginosus (Mart. ex DC.) Mattos Analysis

Handroanthusimpetiginosus (Mart. ex DC.) Mattos “Ipê roxo”, “ipê rosa” or “pink lapacho” “Ipê roxo is a common name for Handroanthusimpeginosus. “Ipê” is a tupi[1] word that main “thick bark tree” and “roxo” is a Brazilian word for purple. Even the flowers being pink the most common name for the tree is purple ipê. The group of Ipês are broadly used in … Read More»

Effect of Exposure to Synthetic Estrogen on Fish Populations

The Effect of Exposure to Synthetic Estrogen on Fish Populations In a world full of pharmaceutical drugs and hormone replacement, pharmacists and toxicologists alike squabble with the implications of improper chemical disposal. Fewer professionals fully analyze how these chemicals are making it into the aquatic environment in ways other than improper disposal and to the … Read More»

Sexual and Asexual Reproduction in Plants

Compare and contrast sexual and asexual reproduction in plants and give medicinal plant examples. Introduction Plants are eukaryotic organisms that evolved over billions of years. There is enormous diversity in reproductive strategy in plants. Eukaryotes have nuclei in each cell that contain DNA coiled into chromosomes. Chromosomes are the organism’s reproductive functional unit and occur in single … Read More»

How Did the Cat Evolve to Become Tame?

How did moggy become so tame? History In Cyprus 9.5 kya, and later Asia, as humans shifted towards more agricultural lifestyles, we see the first evidence of the domestic cat (Felis silvestirs catus) 1, 2. This may have been a result of the benefit cats provide farmers through vermin control. Today, the domestic cat is one of … Read More»

attraction response of mosquitoes when exposed to CDC light traps

Master’s degree proposal Introduction Aedes aegypti As a well-known vector of diseases such as Yellow Fever, Dengue, Chikungunya, and Zika virus the Aedes aegypti have remained a global health issue. The ancestral roots of this species are suspected to have begun in the sub-Saharan region on the continent of Africa as a tree-hole laying mosquito that feeds … Read More»

CGRP Receptor Activation Mechanism and Applications

CGRP Receptor activation Proposal Summary The calcitonin gene-related peptide (CGRP) receptor is a complex of calcitonin receptor-like receptor (CLR) and receptor activity-modifying protein 1 (RAMP1). This receptor plays an important role in vasodilation, neurogenic inflammation and is involved in the pathology of migraine. Though mechanisms have been proposed, it is largely unknown how exactly the … Read More»

Developmental Process of Human Spermatozoa

Human spermatozoa take 74 days to complete their development. Discuss the developmental significance of the process by breaking this period down into the main stages of spermatogenesis, describing them in relation to where in the male reproductive tract these stages are found. The ability of a species to reproduce is a characteristic seen across every domain … Read More»

Evolution of the Human Hand

The Evolution of the Human Hand Introduction The hand is one of the most discernible features of humankind. A key advantage to hominin evolution is the advancement of dexterity and structure of the human thumb. Modern homo sapiens possess a highly distinct thumb considerably stronger than any other digit. Compared to other apes, humans have … Read More»

Unique Function of P53 Homolog P63

P53 homolog p63 has a unique function P53 is commonly known as a transcription factor and is well characterized for its role in DNA damage and cell cycle control (1), but less is known about its related homologous genes, p63 and p73 (2).  While p63 and p73 are very similar in structure to p53, recent literature … Read More»

How can Aspartate Aminotransferases be Exploited in Biocatalysis?

How can Aspartate Aminotransferases be Exploited in Biocatalysis? Background and structure: Aminotransferases (transaminases) are very useful in pharmaceutical drug discovery because of their ability to introduce chirality into amines or amine derived compounds. Aspartate aminotransferase catalyses the reversible transfer of an alpha amino group between aspartate and glutamate. A well-known example of aminotransferases in the … Read More»

Atomic Force Microscopy (AFM) to Obtain Biological Information

How can AFM be used to obtain biological information across a wide range of scales from cell structure and function to single molecule detection?   Atomic Force Microscopy (AFM) is a scanning probe microscopy technique which is commonly used not only for the observation but also for the manipulation of biological macromolecules. This technique is … Read More»

Wheat Disease Resistance like Gene

A UNIQUE WHEAT DISEASE RESISTANCE LIKE GENE GOVERNS EFFETOR TRIGGERED SUCEPTIBILITY TO NECROTROPHIC PATHOGENS   ABSTRACT Tan spot is an important foliar disease of wheat caused by Pyrenophora tritici-repentis. Eight races of this fungus have been identified based on their virulence on a wheat differential set. It is a devastating foliar disease of wheat caused by … Read More»

Glomeruli and Glomerular Filtration Rate (GFR)

The glomeruli are microscopic filters made of a network of capillaries that filter the blood plasma, which occurs in the renal corpuscle of the nephron in the kidneys (figure 1). Glomerular filtration rate (GFR) is defined by amount of blood filtered by the glomerulus into the Bowman’s capsule (ml/per unit of time), the resulting fluid … Read More»

Laboratory Investigation of Gastrointestinal Stromal Tumour

Title: Describe the laboratory investigation of GIST. Gastrointestinal Stromal Tumour (GIST) is one of the most commonly seen mesenchymal neoplasms, a soft tissue sarcoma, present in any area of the gastrointestinal tract (GI tract) and can have extra-gastrointestinal involvement as well. The stomach is the most common site (about 70%). GIST mainly affects middle aged to … Read More»

Importance of Gene Editing and CRISPR | Argument

A detailed explanation of why I think Gene editing and CRISPR are important topics in current biology. The ability to change the DNA of an organism is called gene editing, this technology allows genetic material to be removed, added or altered. This technology was first accomplished in 1972 by Herbert Boyer and Stanley Cohen, since … Read More»

Methods of Transport across a Plasma Membrane Biology

Methods of Transport across a Plasma Membrane Biology The plasma membrane is present in both the eukaryotic and prokaryotic cell and is also known as the biological membrane and. It works as a barrier between the inner and outer surface of a cell hence is also called the cell membrane. In plant cells it is … Read More»

Determining Reactants for Photosynthesis

Photosynthesis Lab Purpose: The purpose of this investigation is study is to determine if reactants such as, light, carbon dioxide or chlorophyll, are essential for photosynthesis to take place. This will be determined through the iodine test, the presence of starch can be determined within the leaves of a geranium plant, variegated plant, and two … Read More»

Super-Resolution Fluorescence Microscopy by Single-Molecule Switching

Super-Resolution Fluorescence Microscopy by Single-Molecule Switching Biological research has been greatly impacted by the invention of fluorescent microscopy (Thorley, Pike and Rappoport, 2014). Although the impact on describing biological processes is revolutionary, diffraction of light is a limiting factor that blurs objects smaller than 250 nm in the x and y direction, and 500 nm … Read More»

Digestive System of a Dog

This essay is going to explain the digestive system of a dog, focusing on how the structure aids the function. The digestive system consists of a collection of organs that all have a variety of roles in order to break down food and absorb nutrients. Figure 1 shows the gastrointestinal (GI) tract of a dog … Read More»

Myosin: A Superfamily of Motor Proteins

Myosin: A Superfamily of Motor Proteins Introduction   Every movement, from moving one’s fingers to looking around, is powered by myosin; myosin is one of only three proteins which are responsible for converting chemical energy into kinetic and mechanical work.1. It consists of a large family of motor proteins which are renowned for their various … Read More»

High Throughput Screening (HTS) Assays: Uses and Formats

the authors and do not necessarily reflect the views of UK Essays. The increasing demands placed upon the pharmaceutical industry to produce a rapid turnaround of new drugs is a driving factor in the automation of the processes at the initial screening stage of drug discovery. This has lead to the development of numerous high … Read More»

Absent Joining Chain Effect on Immune Response

the authors and do not necessarily reflect the views of UK Essays. Critical Review of a Journal Kallberg, E. and Leanderson, T., 2006. Joining-chain (J-chain) negative mice are B cell memory deficient. European Journal of Immunology, 36, 1398-1403. Overview The journal article falls under the main subject area of cellular immune response, where the effect … Read More»

Impact of PCR (Polymerase Chain Reaction) on Biology

the authors and do not necessarily reflect the views of UK Essays. PCR- How has this technique revolutionised molecular biology in the last 30 years? PCR (Polymerase Chain Reaction) has been in existence for several decades now and in that time has become one of the most commonly used of all lab techniques in biology. … Read More»

ATP and Adenosine: Biochemistry and Metabolism

the authors and do not necessarily reflect the views of UK Essays. ATP and adenosine: biochemistry and metabolism Adenosine triphosphate (ATP) is an endogenously occurring nucleoside triphosphate, which is ubiquitous in all cell types and constitutes the natural precursor molecule of adenosine, (AD) a purine nucleoside formed by adenine and ribose. One ATP molecule consists of three … Read More»

Role Of Bacteria In Assisting Cancer

Cancer can be promoted by several pathogenic bacteria to initiate abnormal cell growth by attacking the immune system or suppressing apoptosis (Mager 2006). However, bacterial toxins can still be used for tumor suppressor and cancer vaccines on immunotoxins of bacterial origin(Patyar et al. 2010). Bacterial colonization of tumors was initially attributed to the hypoxic nature of … Read More»

CD8+ effector and memory T cells Differentiation

the authors and do not necessarily reflect the views of UK Essays. What controls CD8+ effector and memory T cells differentiation? Introduction: The capability of initiating and cultivating a population of memory T cells is the key component of an effective adaptive immune response and the fundamental foundation for a productive vaccine since memory cells … Read More»

Analyzing the Phylum Chordata through Biology

the authors and do not necessarily reflect the views of UK Essays. Hamza Ali Introduction: The topic chosen for this biological study was the Kingdom Animalia. This study will specifically be analyzing the Phylum Chordata, by providing an introduction to Chordates, Vertebrates, The Classification method of Cladistics, Fish, Amphibian, and Reptiles. What are vertebrates? -Vertebrates … Read More»

Functions of Food and Food Types

Introduction: A look over past decade shows an evident surge of consumer concern towards the health augmenting role of some specific foods which are refer as functional foods. Evidently all foods that we consume are functional in nature as they dispense specific aroma, taste and nutritive value, however during last decade the term has been … Read More»

Screening of Exopolysaccharides Producing Bacteria Strains

the authors and do not necessarily reflect the views of UK Essays. 1.0 Introduction Among the microbial products, exopolysaccharides (EPSs) play a significant role in main physiological functions and applications. The increased demand for current and natural polymeric materials by several industrial fields such as pharmaceutical, food and others has moved the interest to the … Read More»

Analysis of Water Quality in South Africa's Rivers

the authors and do not necessarily reflect the views of UK Essays. Diseases Related to Microbial Organism’s found in the drinking water in South Africa Shelley-Anne Bentham Due: 17 March 2014 Definitions: cfu/ml: Colony Forming Units per mililitre Keywords: Cholera, Entamoeba Histolticia, Giardia Lamblia and Tricuris Trichuira, Rota Virus, Salmonella Abstract Aim: Is to determine the quality of water … Read More»

Bluetongue Virus (BTV): Causes, Types and History

the authors and do not necessarily reflect the views of UK Essays. The disease was first reported in Pakistan in 1959 and in India in 1964 (Sapre, 1964). After that BT outbreaks have been reported from sheep and goat in several states of India. Being India endemic for BT, 21 different serotypes of BTV have … Read More»

Declining Honey Bee Population: Causes and Effects

the authors and do not necessarily reflect the views of UK Essays. Abstract Introduction Honey Bee (Apis mellifera) numbers have declined significantly in recent years and there are numerous theories as to why. One of the fore runners is the emergence of Colony Collapse Disorder (CCD), which is: “an unsolved decline in honey bees from … Read More»

Using Fish Geometric Morphometric Markers

the authors and do not necessarily reflect the views of UK Essays. Use of Fish Geometric Morphometric Markers for Characterizing Shape Variations of Selected Fishes: Family Leiognathidae in the Marine Waters of Zamboanga City, Western Mindanao, Philippines Roldan T. Echem Abstract [AU1] In this investigation, geometric morphometric analysis was used to determine the extent and … Read More»

Therapeutic Effects of Caffeine

Abstract Caffeine which is part of many beverages like tea, coffee, energy drinks, cola drinks and chocolates is one of the widely used stimulants by the human population all over the world. The consumption of caffeine varies across age groups. Generally adults follow a pattern in the consumption related to the time of the day, … Read More»

Relationship Between Myofibroblasts and Progenitor Cells

the authors and do not necessarily reflect the views of UK Essays. Introduction The liver is an organ with high regenerative ability in case of massive parenchymal cell loss it can restore its mass. Even if often thought of in the circumstance of acute liver damage. The liver reconstitution and regeneration are also related with … Read More»

Life Cycle of the G. Lamblia

Thuy Truc Pham Giardiasis Giardiasis, which is a protozoan infection in human, is caused by Giardia lamblia (synonyms as Giardia intestinalis or Giardia duodenalis). This disease is sometimes known as traveller’s diarrhoea, causing problems all around the world. The causative agent presents in two distinct forms: the disease-causing trophozoite and the dormant infectious cyst. This essay is to review the … Read More»

Oil Degrading Bacteria: History of and Processes

the authors and do not necessarily reflect the views of UK Essays. Oil Degrading Bacteria Introduction Oil degrading bacteria are considered as the dominant hydrocarbon which helps in degrading the aquatic systems such as oceans. These bacteria’s are capable of diverse metabolic pathways which enable them to utilize most recalcitrant petroleum hydrocarbons that are not … Read More»

Protein Precipitation & Isolation of Casein from Milk

the authors and do not necessarily reflect the views of UK Essays. A. Dilshan Jayawickrama Protein Precipitation Methods and Isolation of Casein from Milk Introduction Protein is one of the major constituent of all living organisms on earth which are made up of in a sequence of amino acid. They are linear polymers of amino … Read More»

Master Genes Involved in Cotton Fiber Development

the authors and do not necessarily reflect the views of UK Essays. Cotton fibers are seed trichomes, which are single celled and arose from the epidermal layers of ovules. Fibre formation in cotton has divided into four distinct stages viz; fibre initiation, elongation, secondary cell wall accumulation and maturation. In fiber initiation stage up to … Read More»

Oxygen Production During Photosynthesis

the authors and do not necessarily reflect the views of UK Essays. Oxygen Production During Photosynthesis Meera Kapadia and Amirah Mohd Ariff   Abstract The purpose of this experiment was to investigate the role of light in the production of oxygen gas through photosynthesis. The independent variable for this investigation was the time elapsed between … Read More»

α-glucosidase Inhibitory Effect of Coffee

the authors and do not necessarily reflect the views of UK Essays. Abstract The activity-based fractionation of coffee solutions by a series of chromatography techniques led to the isolation of an active compound I which exhibited a strong inhibitory activity against α-glucosidase. The structure of compound I was established as norharman (9H-pyrido[3.4-b]indole) on the basis … Read More»

Understanding Nutrient Interactions Within Simple Ecosystem

the authors and do not necessarily reflect the views of UK Essays. Jenny Shoener Lab Partners: Garrett, Jilda, & Ying Purpose The purpose of conducting this experiment was to see an overview of how an ecosystem works. Also to view how organisms and the environment interact to carry out a functional system. While observing and … Read More»

Extraction of DNA from Green Split Peas and Chicken Livers

the authors and do not necessarily reflect the views of UK Essays. Lisa Lyons   Abstract: In this experiment, I extracted DNA from the cells of Green Split Peas and Chicken Livers. I used different variables for each. First, I did the experiment with all materials being cold. The second time I did the experiment … Read More»

Dominant Hemisphere of the Brain for Languages

the authors and do not necessarily reflect the views of UK Essays. BRAIN TUMOR A STUDY OF THE DOMINANT HEMISPHERE FOR LANGUAGES IN PATIENTS WITH BRAIN TUMOR Author –Mitali Srivastava ABSTRACT Tumors are deviant organ system containing a convoluted interplay between the neoplastic compartment and recruited vascular, inflammatory, and stromal elements, Human brain tumor consist … Read More»

Role of the Microglia Cells

Joshua Sael Microglia is an endogenous immunohomeostatic neuronal support cells in the Central nervous system (CNS) (Kettenmann et al., 2011). Microglial cells are responsible for surveying brain and spinal cord (invertebrates and vertebrates), in protection from pathogens and injury, phagocytosis, and cytotoxicity and immune homeostasis (Garden and Moller, 2006). Microglia’s homeostatic function achieves profound salubrious … Read More»

Role of Genetics in Obesity

Sabita Tamang Introduction This non-practical research report will include the role of individuals’ genetics in abnormal weight gain (obesity). Obesity is described as someone whose weight is above the normal weight (Medicinenet, 2013). A person is considered to be obese if their weight is 20% above the ideal weight, taking into consideration of their height, age, … Read More»

Analysis of Water Supply for E.Coli

In Canada, the research shows that at least one coliform or pathogenic bacterium present in 28% of water dispensed in workplaces when compared to 22% of contaminated tap water samples (Rim, 2009). The quality of drinking water dispensed from water cooler were complying with the WHO drinking water standard and Egyptian drinking water standard that … Read More»

Acute Eosinophilic Pneumonia (AEP) Caused by Clomipramine

the authors and do not necessarily reflect the views of UK Essays. Clomipramine-induced acute eosinophilic pneumonia-like syndrome leading to acute respiratory failure: a report of first described case Drugs are well-known causes of eosinophilic lung disease and patients with drug-induced eosinophilic lung disease can have variable clinical presentations. Clinical features may range from asymptomatic eosinophilic … Read More»

Management and Mechanism of Amikacin induced Nephrotoxicity

the authors and do not necessarily reflect the views of UK Essays. Jasmeen Kaur Savita Kumari Amit Barwal Dr. Anil Sharma   Abstract— Nephrotoxicity is one of the most common kidney problem. It occurs when the body is exposed to various agents like drugs like aminoglycoside, antimicrobial agents, NSAIDS etc or toxins such as mercury, … Read More»

Pseudomonas Syringae Caused by Avrpt2

the authors and do not necessarily reflect the views of UK Essays. ‘RIN 4 Orthologs’ Maheen Rashid   Introduction Plants are susceptible to a wide range of bacterial diseases. Depending on the origin of the infection, these diseases can be localized within the stems, leaves or the roots of the infected plant. When a human … Read More»

Determining Side Effects of Tumor Size Reducing Drugs

the authors and do not necessarily reflect the views of UK Essays. [APPROACH FOR DETERMINING SIDE EFFECTS OF TUMOR SIZE REDUCING DRUGS] 1. Introduction: Objective: Pfizer have developed a new drug that appears to reduce the size of specific tumors but are concerned about what effect the drug might have on normal tissue. Outline how you … Read More»

Types of Agriculture and Farming

AGRICULTURAL ACTIVITIES Food is the major indispensable, fundamental and vital need of the people. “It has been calculated that a human under stress, performing hard labor, needs 2000grams of water, 470 grams of dry weight various carbohydrates and fats, 60 to 70grams of dry weight proteins and the appropriate amount of vitamins and minerals. Otherwise … Read More»

Proteins for Xylose Utilization

Xylose is the second most abundant sugar in lignocellulosic biomass, comprising up to 35% of the total carbohydrates (Lee, 1997; Saha, 2003; Jeffries and Jin. 2004; Qin et al, 2012). Microorganisms possess three different pathways for D-xylose degradation. The first pathway, present in many bacteria and few fungi, involves xylose isomerase which converts d-xylose to … Read More»

Characterization of Leishmania Major in Dogs

the authors and do not necessarily reflect the views of UK Essays. Characterization of Leishmania major in dogs as a reservoir of the parasite, in Shiraz, southern Iran Summary Cutaneous leishmaniasis (CL) with diverse clinical manifestations is prevalent and remains a major public health problem in Iran and its incidence has been increased over the last decade. … Read More»

Threats to Urban Bird Populations

Emily Bailes, Ann Bailey, Matheus Blezer Plumm, Tom McClellan-West, Lizzie Yarwood – Introduction The enigmatic creatures of the sky, birds are creatures that are treasured by many around the world, by some as cultural symbolism, others a hobby to indulge in and some just find their presence a pleasant addition to a grey and largely urban … Read More»

Analysis of Testicular Histological Structure in Lambs

the authors and do not necessarily reflect the views of UK Essays. Testicular Histological Structure and Scrotal During Postnatal Development till puberty Circumference in Najdi and Naemi Ram Lambs Ahmed A. Al-kawmania,,. Faisal M. Abou-Tarbousha,. Mohammad Abul Faraha,. Mansour M. Alfuraijib,. Salah A. Ibrahima. Abstract The present work is conducted to elucidate the relationship among chronological age, testis … Read More»

Understanding an Unknown Protein Sequence

the authors and do not necessarily reflect the views of UK Essays. Title Understanding an unknown protein sequence provided that was found to be [Physcomitrella patens] >gi|162695322|gb|EDQ81666.1| Seq ID: gi|168001481|ref|XP_001753443.1S Abstract A protein sequence was provided to be subjected to the manipulation of various bioinformatics tools. The protein was found to be a predicted protein … Read More»

DNASE1 VNTR polymorphism and SLE

Deoxyribonuclease I (DNASE1) polymorphism and the risk of systemic lupus erythematosus in Iranian population Milad Mohammadoo-Khorasani1,2 ,Saeedeh Salimi1,2*, Maryam Moossavi3,Mahnaz Sandoughi4, Zahra Zakeri4, Maryam Khoddamian2 Abstract Background: Systemic lupus erythematosus (SLE) is a multisystem autoimmune disease. The etiology of SLE is multi-factorial and both genetic and environmental factors play role. In SLE patients a reduction of DNASE1 … Read More»

Efficacy of Antimicrobial Preservatives

Abstract. The aim of the experiment is to test the efficacy of antimicrobial preservatives by means of investigating the survival of one selected species of micro-organism which is deliberately introduced into the tested products. Introduction. Cosmetic products are not expected to be sterile as the raw materials used in their production, especially those originating from … Read More»

Cell Cycle-related Genes Expression in HGA

the authors and do not necessarily reflect the views of UK Essays. Cell cycle-related genes are prognostic markers of survival in high grade astrocytomas Highlights: A total of 598 genes were identified as significant risk genes for prognosis. Prognosis genes including CDC6 and AURKA had higher degrees in the PPI network. CDC6, AURKA and CHEK1 were mainly enriched in cell cycle and mitotic cell cycle. Abstract Objective: High … Read More»

Bovine Spongy Encephalitis (BSE) in Japan

the authors and do not necessarily reflect the views of UK Essays. The essay aims to investigate the issue of Bovine Spongy Encephalitis (BSE) in Japan, with particular emphasis on the meat traceability system adopted by the Japanese regulatory authorities and its implications for the Japanese food markets, its beef industry, and the hospitality industry. … Read More»

Constraints on the Expansion of Global Food Production

the authors and do not necessarily reflect the views of UK Essays. Introduction It has been observed that In spite of the fact that the food production has increased almost twice in the last few decades, but there are people who are insecure of the food conditions and do not get enough nutritious food to … Read More»

Fatty Acid Analysis of Magnetospirillum Sp

the authors and do not necessarily reflect the views of UK Essays. ABSTRACT: Magnetotactic bacteria (MTB) are ubiquitous in the aquatic environment and have been identified from almost every continent. Magnetospirillumsp., the most studied MTB was commonly found in estuarine and fresh water habitat. The characterstics of bacteria can be determined by computer-assisted fatty acid profiling. … Read More»

Effect of Euonine on Human Uterine Leiomyoma Cells

the authors and do not necessarily reflect the views of UK Essays. Effect of Euonine on the Proliferation and Apoptosis of Human Uterine Leiomyoma Cells Running title: Role of euonine on uterine leiomyoma Highlights: The proliferation rate of uterine leiomyoma cells was determined. The apoptosis rate of uterine leiomyoma cells was determined. The phosphorylation levels of … Read More»

Surgical Extraction of a Large Left Ventricular Hydatid Cyst

the authors and do not necessarily reflect the views of UK Essays. Surgical extraction of a large left ventricular hydatid cyst under transesophageal echocardiography monitoring Abstract We describe the case of a 13-year-old girl who was diagnosed both hepatic and cardiac hydatid cysts by multimodality imaging. The left ventricular hydatid cyst was surgically removed not only … Read More»

Impact of Increased Temperature on Delosperma Cooperi

the authors and do not necessarily reflect the views of UK Essays. Eunice Oh The Impact of Increased Temperature due to Global Warming on Pollen Germination ofDelosperma Cooperi Introduction: There have is an ongoing crisis that is beginning to influence ecosystems throughout the world, which may lead to been large scalemany natural disasters and impacts due to a rise in earth’s temperature,due to the … Read More»

Biological Significance of BST2 Overexpression in OSCC

the authors and do not necessarily reflect the views of UK Essays. Overexpression of BST2 is associated with nodal metastasis and poorer prognosis in oral cavity cancer ABSTRACT Objective: Bone marrow stromal cell antigen 2 (BST2) was one of the proteins which were found related to tumor metastasis in our previous proteomic study. Now we want to … Read More»

Impact of Climate Change on Moose Numbers

the authors and do not necessarily reflect the views of UK Essays. Moose in the Noose? From Montana to Minnesota, Ontario and Wyoming to Hew Hampshire moose numbers are in steep decline. Could climate change be to blame? These majestic animals, which can be over 6 feet tall and weigh 700 kg, are a highlight … Read More»

Literature Review on Butea Monosperma (Lam.)

the authors and do not necessarily reflect the views of UK Essays. LITERATURE SURVEY Butea monosperma (Lam.) Taub. (Fabaceae) 1. Botanical synonyms Butea frondosa Koenig ex Roxb; Erythrina monosperma Lamk. 1.2. Common names Bengali: kinaka, palas, paras, polashi; English: flame of the forest; Gujarati: kakria, kesudo, khakara, khakharo, palasso, phullas; Hindi: chinchra, dhak, palas, paras; Kannada: brahmavriksha, mathuga, mutthugada … Read More»

Do Meal-worms Prefer the Dark? Experiment

the authors and do not necessarily reflect the views of UK Essays. Joseph, Jesse, and Hannah Biology-0/1st Behavior Lab- Mealworms Introduction: Mealworms, scientifically known as Tenebrio molitor, are the brown and white colored worm-like larvae of the darkling beetles. They go through a life cycle of transforming from larvae into pupa and then finally into adult … Read More»

Strategies of Gene Sequencing

Databanks When a gene is sequenced for the first time, it is submitted to a databank such as DNA Data Bank of Japan (DDBJ), GenBank or European Molecular Biology Laboratory (EMBL). The submission of the nucleotide sequence databanks via the internet, undergo a simple automatic process which done electronically with web-based procedures. The databanks that … Read More»

Applications of Probiotics

Probiotics: A Biotherapeutics Application of Potentially Beneficial Microorganisms Vandana Bharti*, Archana Mehta, Siddharts Singh and Neha Jain, Shuchi Mehta   ABSTRACT The term “Probiotics” comes from the Greek word “pro bios” meaning “for life”. Use of Probiotics are not a new invention but it has formed a vital part of diets for thousands of years, … Read More»

Methods of Pest Control for Crop Productivity

the authors and do not necessarily reflect the views of UK Essays. CHAPTER 2 LITERATURE REVIEW Crop productivity is highly affected by the presence of pests. Insect pests are one of the major causes of low agricultural yield worldwide (Ferre et al., 2008). In spite of the crop protection measurements, large number of crop is lost … Read More»

STAT-3 and the Invasion of Cervical Cancer Cell Relationship

the authors and do not necessarily reflect the views of UK Essays. CHAPTER 1 INTRODUCTION Cervical cancer is one of the most highly leading cancers among the women in the world. The estimated number of cervical cancer cases and death in the world is increase to 527,624 and 265,653 respectively in year 2012 (Saranath & … Read More»

Impact of Human Population Growth

The Growth of the Human Population Chris Long   Since the worlds origin we have seen a steady growth in the worldwide population. From the first records of humans on this earth we have seen the cycle of birth and death. The population increases and decreases are determined by the number of births compared with … Read More»

Major Discoveries in Modern Biology

Emily Faulkner BIOLOGY is a major branch of science that deals with the living organisms. Many discoveries are emerged in this area and the focus of this paper is on major discoveries of modern biology in the field of DNA, biotechnology and cell biology. Cell Biology Nature Cell Biologywas proposed 10 years ago to give … Read More»

Relationship Between Exercise and Reaction Time: Research

the authors and do not necessarily reflect the views of UK Essays. EXERCISE AND REACTION TIME RESEARCH QUESTION: How, and to what extent, do varying intensities of aerobic exercise affect the visual and auditory reaction times of males between ages 15-20? INTRODUCTION: The field of reaction time has been one with much interest and study … Read More»

Genetically Inherited Diseases: Gaucher’s Disease

the authors and do not necessarily reflect the views of UK Essays. Nikita Mountford   1. what is a genetically inherited disease? Genetic disorders are typically inherited (passed down) in either a dominant or recessive way. We each have two copies of every gene on our 22 numbered chromosomes. When a disorder is dominant, the … Read More»

Anti Cancer Activity of Some Novel Quinazoline Derivatives

the authors and do not necessarily reflect the views of UK Essays. Abstract At present, the criteria used to select finest novel anticancer drug candidates include inhibitors of cell proliferation, necessary reaction and pathways in cancerous cells. In silico advance resulting in the identification of essential reactions and pathways spreads across several parts of metabolism. … Read More»

In-vitro Study of Hexane Fraction of P. Niruri Whole Plant

the authors and do not necessarily reflect the views of UK Essays. Effect of hexane fraction of P. niruri on glucose uptake in L6 cells: Figure 79 represents the effect of hexane fractions of P. niruri whole plant, insulin and metformin on glucose uptake by L-6 myotubes. It is evident from the results that hexane fraction of P. niruri caused increases … Read More»

Transferability of Simple Sequence Repeat (SSR) Markers

the authors and do not necessarily reflect the views of UK Essays. Transferability of simple sequence repeat (SSR) markers developed in red clover (Trifolium pratense L.) to some Trifolium species Abstract Microsatellite markers previously developed for red clover (Trifolium pratense L.) were used in cross-amplification tests of eight other Trifolium species. Of the 20 SSR loci tested, 9 (47.37%) had positive results and were … Read More»

Effect of Oxygen and Oxidative Stress on Ageing

the authors and do not necessarily reflect the views of UK Essays. Critically discuss the research evidence that oxygen and oxidative stress are responsible for ageing For decades there have been hundreds of hypotheses regarding theories of ageing (finch). Most of these ideas have been disregarded and several theories now captivate much research on ageing. … Read More»

Relationship between Amyloid-/I and Oxidative Stress

the authors and do not necessarily reflect the views of UK Essays. Oxidative stress increases amyIoid-~production, and, conversely, amybid-/ I increases oxidative damage. To address the relationship between amyloid-/I and oxidative stress in vivo, we examined, using an array of oxidative markers, transgenic mice that overexpress amyloid-/3 precursor protein and, as in Alzheimer’s disease, develop … Read More»

Bacterial Transcription Initiation

YONG YA FEN What are the mechanisms of bacterial transcription initiation? The transcription initiation is dependent on the interaction between RNA polymerase and promoter. The way that RNA polymerase interacts with promoter determines the direction for transcription because it decides which DNA strand to be the template strand and the site where transcription begins (Russell, … Read More»

Cell Culture for Producing Influenza Vaccines

the authors and do not necessarily reflect the views of UK Essays. Cell Culture: an Alternative Method for Producing Influenza Vaccines Layth Abdul-Majeed Abdul-Khaleq   Importance of the field: Cell culture-based method for influenza vaccines production offers various advantages over egg-based manufacturing method during influenza pandemics. Areas covered in this review: Benefits of cell culture-based method for … Read More»

Morphological Characterization of Aromatic Pickle Mango

the authors and do not necessarily reflect the views of UK Essays. Morphological Characterization of a few Farmers’-Identified Unique Aromatic Pickle Mango varieties of the Central Western Ghats Manohar Sunagar, Vasudeva R, Bhuwon R. Sthapit and V. Ramanatha Rao   Key words: Aromatic pickle-mango, morphological characterization, descriptors, farmers varieties Abstract Aromatic pickle mango (locally called appemidi and GI … Read More»

Effects of Tai Chi on Bone Mineral Density

the authors and do not necessarily reflect the views of UK Essays. The Effects of Tai Chi on Bone Mineral Density in Postmenopausal Women: A meta-analysis of Randomized Control Trials Running title: A meta-analysis of Tai Chi and BMD Highlights: This was a meta-analysis of randomized control trials. A total of 6 articles involving 182 interventions and 168 controls were included. Meta-analysis of BMD at lumbar spine … Read More»

Correlation of Phenotypic Traits in Maize Different Hybrids

the authors and do not necessarily reflect the views of UK Essays. Evaluation correlation between phenotypic traits in corn hybrids and their change trends under drought stress and non-stress conditions at flowering and grain filling stages Rahim mohammadian,Behnam tahmasebpour, Peyvand Samimifar,Habib Lotfi Abstract To investigate the correlation of phenotypic traits in maize different hybrids, an experiment was conducted … Read More»

Analysis of Rat Pancreatic Islets

Discussion We here report, for the first time, that rat pancreatic islet cells and the rat INS-1 β-cell line express detectable levels of transcripts encoding the key enzymes of the TKP. Importantly, this is associated with the spontaneous release of significant levels of the TKP metabolites KYN and KYNA by the rat islets, therefore suggesting some degree … Read More»

Metabolic Pathways of Galactosemia

An Overview of Galactosemia and Its comparison to Electron Transport Chain and Medium Chain Acyl-CoA Dehydrogenase Deficiency Yu Shang Any deficiencies of the enzymes in a metabolic pathway will likely lead to a metabolic disorder. Galactosemia is an autosomal recessive disorder of galactose metabolism.1 The disease is caused by the deficiency in galactokiase (GALK), galactose-1-phosphate uridyltransferase … Read More»

Quantified Amount of Beta Carotene from Galiella Sp

the authors and do not necessarily reflect the views of UK Essays. Chapter IV PRESENTATION, ANALYSIS AND INTERPRETATION OF DATA This chapter presents the results on quantified value of beta – glucan and beta – carotene from Galiella sp. extracts. Analysis of beta – glucan contents Table 1. Quantified amount of beta – glucan from thallus The table shows … Read More»

Chemistry of Contraceptives

Chapter 3 REVIEW OF LITERATURE 3.1 Norethindrone Norethindrone is 17α-ethinyl-17β-hydroxy-4-estren-3-one. It is also known by its chemical names like norpregneninolone and norethisterone. It is commonly used in some combined oral contraceptive pills, progestogen only pills and is also available as a stand-alone drug. It is white to creamy white in color, odorless, non-hygroscopic, crystalline powder. Norethindrone was the … Read More»

Bamboo as a Source of Phytosterols

Functional foods containing phytosterols are now available in the form of margarines, spreads, baked products, meat, soups and salad dressings. Present sources of phytosterols are limited being derived from vegetable oil and tall oil, a by-product of paper production from wood, and it is estimated that 2500 tons of these oils need to be refined … Read More»

Biological Effects of Smoking on Health

Kim Rissario A report into the biological effects of smoking on health Cigarette smoke is composed of over 4000 different chemicals, many of which are extremely toxic. Cigarettes consist of the following components; tar, nicotine and Carbon Monoxide (CO), which are hazardous to our health. The tar settles in the lungs and stimulates a series … Read More»

The Ethics of Human Enhancement

Bor Shin Chee Human Enhancement The term ‘human enhancement’ embraces a range of approaches to improve aspects of human function such as memory, hearing and mobility to improve human performance, hence raising these function to a level considered to be beyond the existing human range. Human enhancement categorized into particular areas: life extension, physical enhancement, … Read More»

Extraction of Antioxidant Compounds From Lichens

the authors and do not necessarily reflect the views of UK Essays. Efficient method of extraction and separation of antioxidant molecules from Lichens obtained from Kolli hills of Tamil Nadu Abstract Lichens are made by symbiotic association of both fungi and algae. The fungi was found to be the major partner and in the metabolite … Read More»

Pluripotent Stem Cells: Benefits, Properties and Uses

the authors and do not necessarily reflect the views of UK Essays. INTRODUCTION Pluripotent stem cells give rise to nearly all cells types of the body, like, muscle, nerve, heart, and blood. They hold huge promise for both research & health care. The advance in human biology continues to generate interest among scientists, patients suffering … Read More»

Effect of Different Substrate and Temperature on Yeast

the authors and do not necessarily reflect the views of UK Essays. background information introduction to cellular respiration Cellular respiration is the catabolic process of converting the chemical energy stored in chemical bonds into energy in the form of adenosine triphosphate ATP. Adenosine triphosphate is a high energy molecule, used in cells as a “molecular … Read More»

Alzheimer's Disease and Calcium Signalling

the authors and do not necessarily reflect the views of UK Essays. The pathogenesis of Alzheimer’s disease is complex, and involves many molecular, cellular and physiological pathologies. The leading candidate for the trigger of Alzheimer’s disease is the Aβ peptide,which is produced by the proteolytic processing of the amyloid precursor protein (APP; BOX 1). Its … Read More»

Analysis of Nilaparavata Lugens (Stal.)

Nilaparavata lugens (Stal.) Nilaparvata lugens is generally called as brown plant hopper or Asian rice brown plant hopper (BPH). N. lugens comes under order: Hemiptera, Suborder: Auchennorrhyncha and Family: Delphacidae. The delphacid genus Nilaparvata consists of 18 species. Nilaparvata is a crucial genus economically, with one amongst its member N. lugens being serious insect pests of rice and are cosmopolitian particularly in tropical Asia wherever … Read More»

Role of Cell Signalling in Regulation of Homeostasis

the authors and do not necessarily reflect the views of UK Essays. NEHA HITENDRA RANE Introduction What is Homeostasis? Homeostasis is the ability to maintain a constant internal environment in response to environmental changes. Homeostasis is a ability to maintain relatively stable internal conditions even though there is continuous change in outside world. The term … Read More»

Impacts on Population Growth

Submitted By MUHAMMAD BILAL   Contents (Jump to) 1. POPULATION 2. POPULATION GROWTH WITHOUT ANY REGULATION 2.1 BIOTIC POTENTIAL 2.2 EXPONANTIOAL GROWTH EXAMPLE 2.2.1 ASSUMPTIONS OF EXPONENTIAL GROWTH 2.2.2 APPLICATIONS OF THE EXPONENTIAL MODEL 3. POPULATION REGULATION 3.1 EXTRENSIC FACTORS 3.1.1 ABIOTIC FACTORS 3.1.2 BIOTIC FACTORS 3.2 INTRINSIC FACTORS 4. DENSITY INDEPENDENT FACTORS 4.1 CLIMATE … Read More»

Pink Disease of the Rubber Tree: Causes and Effects

the authors and do not necessarily reflect the views of UK Essays. INTRODUCTION The rubber tree is the most important source of natural rubber. It is constantly under threat from various pathogens that cause severe diseases like abnormal leaf fall, Corynespora leaf disease, brown root disease, and pink disease and Colletotrichum leaf disease. Leaves alternate, … Read More»

Production of Mutant Based Epsilon Toxin (ETK) Vaccines

the authors and do not necessarily reflect the views of UK Essays. Critique of Li et al. Article: A low-toxic site-directed mutant of Clostridium perfringens É›-toxin as a potential candidate vaccine against enterotoxemia Name: Donnelle Phillips Vaccines improve the immune system of an animal or human by stimulating the production of antibodies to fight and combat … Read More»

Annotated Bibliography: Bt Cotton Studies

the authors and do not necessarily reflect the views of UK Essays. LITERATURE REVIEW Tabashnik et al. explained that using transgenic crops such as Bt cotton could significantly reduce the use of chemical insecticides and pesticides. They also pointed out that excessive use of transgenic crops initiated the development of resistance in pests, which must be … Read More»

Risks to the Human Population

Human Populations are at Risk from outbreaks of New Diseases Diseases are the disturbance of body processes impacting homeostasis, the emergence and resurgence of diseases is majorly dependent on social, ecological and geographical change rather than the molecular or microbiological aspects (Mayer, 2000). This essay will cover the growing evidence that climate change poses health … Read More»

The Future for Clinical Immunology

A.N. Other (SID ), Department of Pathobiology, University of Turku, Finland. The last ten years has seen a tremendous increase in our understanding of the molecular basis of different disorders. clinical immunology is a specialism which is currently developing in different ways, some of which are highlighted here. This discipline has a responsibility to provide … Read More»

Exogenous IL-10 and Golimumab for Heart Failure Treatment

Synergistic Effect of Exogenous IL-10 and Golimumab in the Treatment for Heart Failure in Rats Running title: Heart Failure Treatment Highlights: The level of TNF-α decreased after treatment with IL-10 and golimumab. The level of IL-10 was increased by IL-10 combined with golimumab. IL-10 and golimumab have a synergistic effect on HF in rats. ABSTRACT Objectives We attempted … Read More»

Multi-slice Computer Tomography (MSCT) Analysis of Nodules

Multi-slice Computer Tomography (MSCT) Analysis of Benign and Malignant Nodules in Patients With Chronic Lymphocytic Thyroiditis Highlights MSCT features is useful in differentiate the benign and malignant nodules in CLT patients. MSCT is superior than plain CT scan in nodule diagnosis in CLT patients MSCT may apply as an important diagnostic modality in the clinical … Read More»

High Throughput Screening (HTS) Assays: Uses and Formats

The increasing demands placed upon the pharmaceutical industry to produce a rapid turnaround of new drugs is a driving factor in the automation of the processes at the initial screening stage of drug discovery. This has lead to the development of numerous high throughput screening (HTS) assays, with the increasing miniaturization of the whole process … Read More»

Absent Joining Chain Effect on Immune Response

Critical Review of a Journal Kallberg, E. and Leanderson, T., 2006. Joining-chain (J-chain) negative mice are B cell memory deficient. European Journal of Immunology, 36, 1398-1403. Overview The journal article falls under the main subject area of cellular immune response, where the effect of the absence of joining chain locus on T- cell dependent immune … Read More»

Impact of PCR (Polymerase Chain Reaction) on Biology

PCR- How has this technique revolutionised molecular biology in the last 30 years? PCR (Polymerase Chain Reaction) has been in existence for several decades now and in that time has become one of the most commonly used of all lab techniques in biology. In its simplest form it is a way of enzymatically replicating a … Read More»

ATP and Adenosine: Biochemistry and Metabolism

ATP and adenosine: biochemistry and metabolism Adenosine triphosphate (ATP) is an endogenously occurring nucleoside triphosphate, which is ubiquitous in all cell types and constitutes the natural precursor molecule of adenosine, (AD) a purine nucleoside formed by adenine and ribose. One ATP molecule consists of three phosphate groups, and is synthetized by several enzymes, namely ATP synthase, from … Read More»

Role Of Bacteria In Assisting Cancer

Cancer can be promoted by several pathogenic bacteria to initiate abnormal cell growth by attacking the immune system or suppressing apoptosis (Mager 2006). However, bacterial toxins can still be used for tumor suppressor and cancer vaccines on immunotoxins of bacterial origin(Patyar et al. 2010). Bacterial colonization of tumors was initially attributed to the hypoxic nature of … Read More»

CD8+ effector and memory T cells Differentiation

What controls CD8+ effector and memory T cells differentiation? Introduction: The capability of initiating and cultivating a population of memory T cells is the key component of an effective adaptive immune response and the fundamental foundation for a productive vaccine since memory cells can trigger an aggressive response upon reinfection. Throughout an infection, T cells … Read More»

Analyzing the Phylum Chordata through Biology

Hamza Ali Introduction: The topic chosen for this biological study was the Kingdom Animalia. This study will specifically be analyzing the Phylum Chordata, by providing an introduction to Chordates, Vertebrates, The Classification method of Cladistics, Fish, Amphibian, and Reptiles. What are vertebrates? -Vertebrates are known as animals that have an internal spine made of bone.Vertebrates … Read More»

Functions of Food and Food Types

Introduction: A look over past decade shows an evident surge of consumer concern towards the health augmenting role of some specific foods which are refer as functional foods. Evidently all foods that we consume are functional in nature as they dispense specific aroma, taste and nutritive value, however during last decade the term has been … Read More»

Screening of Exopolysaccharides Producing Bacteria Strains

1.0 Introduction Among the microbial products, exopolysaccharides (EPSs) play a significant role in main physiological functions and applications. The increased demand for current and natural polymeric materials by several industrial fields such as pharmaceutical, food and others has moved the interest to the polysaccharides produced by microorganism during the past years. Polysaccharide is a macromolecule … Read More»

Blood Protozoan Disease Theileriosis: Causes and Prevalence

The genesis of the problem has been the introduction of the 6 cows from Rajasthan, a hot and dry state of India in the Holstein cross bred herd in the Graphic Era University dairy at Dehradun capital of hill state of India. Suddenly after introduction of these Sindhi cows there was death of death of … Read More»

Analysis of Water Quality in South Africa’s Rivers

Diseases Related to Microbial Organism’s found in the drinking water in South Africa Shelley-Anne Bentham Due: 17 March 2014 Definitions: cfu/ml: Colony Forming Units per mililitre Keywords: Cholera, Entamoeba Histolticia, Giardia Lamblia and Tricuris Trichuira, Rota Virus, Salmonella Abstract Aim: Is to determine the quality of water in the rivers of South Africa and determine the amount of pollution … Read More»

Bluetongue Virus (BTV): Causes, Types and History

The disease was first reported in Pakistan in 1959 and in India in 1964 (Sapre, 1964). After that BT outbreaks have been reported from sheep and goat in several states of India. Being India endemic for BT, 21 different serotypes of BTV have been reported (Prasad, 2000). However, recently the 22nd serotype i.e. BTV21 has … Read More»

Declining Honey Bee Population: Causes and Effects

Abstract Introduction Honey Bee (Apis mellifera) numbers have declined significantly in recent years and there are numerous theories as to why. One of the fore runners is the emergence of Colony Collapse Disorder (CCD), which is: “an unsolved decline in honey bees from parts of the United States, Europe, and Asia” (Evans and Schwarz 2011). … Read More»

Using Fish Geometric Morphometric Markers

Use of Fish Geometric Morphometric Markers for Characterizing Shape Variations of Selected Fishes: Family Leiognathidae in the Marine Waters of Zamboanga City, Western Mindanao, Philippines Roldan T. Echem Abstract [AU1] In this investigation, geometric morphometric analysis was used to determine the extent and degree of morphological diversity within and among four species of fishes under … Read More»

Therapeutic Effects of Caffeine

Abstract Caffeine which is part of many beverages like tea, coffee, energy drinks, cola drinks and chocolates is one of the widely used stimulants by the human population all over the world. The consumption of caffeine varies across age groups. Generally adults follow a pattern in the consumption related to the time of the day, … Read More»

Relationship Between Myofibroblasts and Progenitor Cells

Introduction The liver is an organ with high regenerative ability in case of massive parenchymal cell loss it can restore its mass. Even if often thought of in the circumstance of acute liver damage. The liver reconstitution and regeneration are also related with fibrosis in acute liver damage. It is provided by recent literature that … Read More»

Life Cycle of the G. Lamblia

Thuy Truc Pham Giardiasis Giardiasis, which is a protozoan infection in human, is caused by Giardia lamblia (synonyms as Giardia intestinalisor Giardia duodenalis). This disease is sometimes known as traveller’s diarrhoea, causing problems all around the world. The causative agent presents in two distinct forms: the disease-causing trophozoite and the dormant infectious cyst. This essay is to review the … Read More»

Oil Degrading Bacteria: History of and Processes

Oil Degrading Bacteria Introduction Oil degrading bacteria are considered as the dominant hydrocarbon which helps in degrading the aquatic systems such as oceans. These bacteria’s are capable of diverse metabolic pathways which enable them to utilize most recalcitrant petroleum hydrocarbons that are not present in fungi. In recent years the microbial biodegradation of pollutants is a sustainable … Read More»

Protein Precipitation & Isolation of Casein from Milk

A. Dilshan Jayawickrama Protein Precipitation Methods and Isolation of Casein from Milk Introduction Protein is one of the major constituent of all living organisms on earth which are made up of in a sequence of amino acid. They are linear polymers of amino acids with high molecular weights which are known as macromolecules. Protein contain … Read More»

Master Genes Involved in Cotton Fiber Development

Cotton fibers are seed trichomes, which are single celled and arose from the epidermal layers of ovules. Fibre formation in cotton has divided into four distinct stages viz; fibre initiation, elongation, secondary cell wall accumulation and maturation. In fiber initiation stage up to 15-25% of epidermal cells of cotton ovules are differentiated into lint fibers … Read More»

Oxygen Production During Photosynthesis

Oxygen Production During Photosynthesis Meera Kapadia and Amirah Mohd Ariff   Abstract The purpose of this experiment was to investigate the role of light in the production of oxygen gas through photosynthesis. The independent variable for this investigation was the time elapsed between recordings of the location of the sodium bicarbonate edge; the dependent variable … Read More»

α-glucosidase Inhibitory Effect of Coffee

Abstract The activity-based fractionation of coffee solutions by a series of chromatography techniques led to the isolation of an active compound I which exhibited a strong inhibitory activity against α-glucosidase. The structure of compound I was established as norharman (9H-pyrido[3.4-b]indole) on the basis of HR-FAB-MS, 1H NMR, 13C NMR and 1H-1H COSY spectra. Compound I potently inhibited α-glucosidase … Read More»

Understanding Nutrient Interactions Within Simple Ecosystem

Jenny Shoener Lab Partners: Garrett, Jilda, & Ying Purpose The purpose of conducting this experiment was to see an overview of how an ecosystem works. Also to view how organisms and the environment interact to carry out a functional system. While observing and experimenting, it would show how the cycles work together along with organisms … Read More»

Extraction of DNA from Green Split Peas and Chicken Livers

Lisa Lyons   Abstract: In this experiment, I extracted DNA from the cells of Green Split Peas and Chicken Livers. I used different variables for each. First, I did the experiment with all materials being cold. The second time I did the experiment with materials at room temperature. My objective was to see which method … Read More»

Dominant Hemisphere of the Brain for Languages

BRAIN TUMOR A STUDY OF THE DOMINANT HEMISPHERE FOR LANGUAGES IN PATIENTS WITH BRAIN TUMOR Author –Mitali Srivastava ABSTRACT Tumors are deviant organ system containing a convoluted interplay between the neoplastic compartment and recruited vascular, inflammatory, and stromal elements, Human brain tumor consist of multitude of various different tumors that can be distinguish at both … Read More»

Role of the Microglia Cells

Joshua Sael Microglia is an endogenous immunohomeostatic neuronal support cells in the Central nervous system (CNS) (Kettenmann et al., 2011). Microglial cells are responsible for surveying brain and spinal cord (invertebrates and vertebrates), in protection from pathogens and injury, phagocytosis, and cytotoxicity and immune homeostasis (Garden and Moller, 2006). Microglia’s homeostatic function achieves profound salubrious … Read More»

Role of Genetics in Obesity

Sabita Tamang Introduction This non-practical research report will include the role of individuals’ genetics in abnormal weight gain (obesity). Obesity is described as someone whose weight is above the normal weight (Medicinenet, 2013). A person is considered to be obese if their weight is 20% above the ideal weight, taking into consideration of their height, age, … Read More»

Analysis of Water Supply for E.Coli

In Canada, the research shows that at least one coliform or pathogenic bacterium present in 28% of water dispensed in workplaces when compared to 22% of contaminated tap water samples (Rim, 2009). The quality of drinking water dispensed from water cooler were complying with the WHO drinking water standard and Egyptian drinking water standard that … Read More»

Acute Eosinophilic Pneumonia (AEP) Caused by Clomipramine

Clomipramine-induced acute eosinophilic pneumonia-like syndrome leading to acute respiratory failure: a report of first described case Drugs are well-known causes of eosinophilic lung disease and patients with drug-induced eosinophilic lung disease can have variable clinical presentations. Clinical features may range from asymptomatic eosinophilic infiltrates to acute eosinophilic pneumonia (AEP)-like syndrome leading to acute respiratory failure. … Read More»

Management and Mechanism of Amikacin induced Nephrotoxicity

Jasmeen Kaur Savita Kumari Amit Barwal Dr. Anil Sharma   Abstract— Nephrotoxicity is one of the most common kidney problem. It occurs when the body is exposed to various agents like drugs like aminoglycoside, antimicrobial agents, NSAIDS etc or toxins such as mercury, lead, arsenic etc. Aminoglycosides are one of the oldest antibiotics used to … Read More»

Pseudomonas Syringae Caused by Avrpt2

‘RIN 4 Orthologs’ Maheen Rashid   Introduction Plants are susceptible to a wide range of bacterial diseases. Depending on the origin of the infection, these diseases can be localized within the stems, leaves or the roots of the infected plant. When a human body is compromised, as a result of it being infected by a … Read More»

Determining Side Effects of Tumor Size Reducing Drugs

[APPROACH FOR DETERMINING SIDE EFFECTS OF TUMOR SIZE REDUCING DRUGS] 1. Introduction: Objective: Pfizer have developed a new drug that appears to reduce the size of specific tumors but are concerned about what effect the drug might have on normal tissue. Outline how you would use DNA technology to address this issue. Cancer disease has large … Read More»

Types of Agriculture and Farming

AGRICULTURAL ACTIVITIES Food is the major indispensable, fundamental and vital need of the people. “It has been calculated that a human under stress, performing hard labor, needs 2000grams of water, 470 grams of dry weight various carbohydrates and fats, 60 to 70grams of dry weight proteins and the appropriate amount of vitamins and minerals. Otherwise … Read More»

Proteins for Xylose Utilization

Xylose is the second most abundant sugar in lignocellulosic biomass, comprising up to 35% of the total carbohydrates (Lee, 1997; Saha, 2003; Jeffries and Jin. 2004; Qin et al, 2012). Microorganisms possess three different pathways for D-xylose degradation. The first pathway, present in many bacteria and few fungi, involves xylose isomerase which converts d-xylose to … Read More»

Characterization of Leishmania Major in Dogs

Characterization of Leishmania major in dogs as a reservoir of the parasite, in Shiraz, southern Iran Summary Cutaneous leishmaniasis (CL) with diverse clinical manifestations is prevalent and remains a major public health problem in Iran and its incidence has been increased over the last decade. The primary hosts of Leishmania are sylvatic mammals of several orders (Rodentia, … Read More»

Threats to Urban Bird Populations

Emily Bailes, Ann Bailey, Matheus Blezer Plumm, Tom McClellan-West, Lizzie Yarwood – Introduction The enigmatic creatures of the sky, birds are creatures that are treasured by many around the world, by some as cultural symbolism, others a hobby to indulge in and some just find their presence a pleasant addition to a grey and largely urban … Read More»

Analysis of Testicular Histological Structure in Lambs

Testicular Histological Structure and Scrotal During Postnatal Development till puberty Circumference in Najdi and Naemi Ram Lambs Ahmed A. Al-kawmania,,. Faisal M. Abou-Tarbousha,. Mohammad Abul Faraha,. Mansour M. Alfuraijib,. Salah A. Ibrahima. Abstract The present work is conducted to elucidate the relationship among chronological age, testis size, and the postnatal development of the seminiferous epithelium of the testes … Read More»

Understanding an Unknown Protein Sequence

Title Understanding an unknown protein sequence provided that was found to be [Physcomitrella patens] >gi|162695322|gb|EDQ81666.1| Seq ID: gi|168001481|ref|XP_001753443.1S Abstract A protein sequence was provided to be subjected to the manipulation of various bioinformatics tools. The protein was found to be a predicted protein of Physcomitrella patens that is an important bryophyte that is utilised in general genomic … Read More»

DNASE1 VNTR polymorphism and SLE

Deoxyribonuclease I (DNASE1) polymorphism and the risk of systemic lupus erythematosus in Iranian population Milad Mohammadoo-Khorasani1,2 ,Saeedeh Salimi1,2*, Maryam Moossavi3,Mahnaz Sandoughi4, Zahra Zakeri4, Maryam Khoddamian2 Abstract Background: Systemic lupus erythematosus (SLE) is a multisystem autoimmune disease. The etiology of SLE is multi-factorial and both genetic and environmental factors play role. In SLE patients a reduction of DNASE1 … Read More»

Efficacy of Antimicrobial Preservatives

Abstract. The aim of the experiment is to test the efficacy of antimicrobial preservatives by means of investigating the survival of one selected species of micro-organism which is deliberately introduced into the tested products. Introduction. Cosmetic products are not expected to be sterile as the raw materials used in their production, especially those originating from … Read More»

Cell Cycle-related Genes Expression in HGA

Cell cycle-related genes are prognostic markers of survival in high grade astrocytomas Highlights: A total of 598 genes were identified as significant risk genes for prognosis. Prognosis genes including CDC6 and AURKA had higher degrees in the PPI network. CDC6, AURKA and CHEK1 were mainly enriched in cell cycle and mitotic cell cycle. Abstract Objective: High grade astrocytoma (HGA) is a kind of aggressive brain tumor. Moreover, the … Read More»

Bovine Spongy Encephalitis (BSE) in Japan

The essay aims to investigate the issue of Bovine Spongy Encephalitis (BSE) in Japan, with particular emphasis on the meat traceability system adopted by the Japanese regulatory authorities and its implications for the Japanese food markets, its beef industry, and the hospitality industry. Presumably written in late 2005 or early 2006, some three years after … Read More»

Constraints on the Expansion of Global Food Production

Introduction It has been observed that In spite of the fact that the food production has increased almost twice in the last few decades, but there are people who are insecure of the food conditions and do not get enough nutritious food to eat (Wu et al. 2011). As per the world population data the people who … Read More»

Fatty Acid Analysis of Magnetospirillum Sp

ABSTRACT: Magnetotactic bacteria (MTB) are ubiquitous in the aquatic environment and have been identified from almost every continent. Magnetospirillumsp., the most studied MTB was commonly found in estuarine and fresh water habitat. The characterstics of bacteria can be determined by computer-assisted fatty acid profiling. Three strains of Magnetospirillumsp. was grown for 72 hours under defined cultural conditions … Read More»

Effect of Euonine on Human Uterine Leiomyoma Cells

Effect of Euonine on the Proliferation and Apoptosis of Human Uterine Leiomyoma Cells Running title: Role of euonine on uterine leiomyoma Highlights: The proliferation rate of uterine leiomyoma cells was determined. The apoptosis rate of uterine leiomyoma cells was determined. The phosphorylation levels of EGFR from uterine leiomyoma cells were measured. Abstract Objective: To explore the effect … Read More»

Surgical Extraction of a Large Left Ventricular Hydatid Cyst

Surgical extraction of a large left ventricular hydatid cyst under transesophageal echocardiography monitoring Abstract We describe the case of a 13-year-old girl who was diagnosed both hepatic and cardiac hydatid cysts by multimodality imaging. The left ventricular hydatid cyst was surgically removed not only under direct vision but transesophageal echocardiography monitoring. And the patient recovered uneventfully. … Read More»

Impact of Increased Temperature on Delosperma Cooperi

Eunice Oh The Impact of Increased Temperature due to Global Warming on Pollen Germination of DelospermaCooperi Introduction: There have is an ongoing crisis that is beginning to influence ecosystems throughout the world, which may lead tobeen large scalemany natural disasters and impacts due to a rise in earth’s temperature, due to the rise in temperature from the global warming. According to NASA’s Goddard Institute for Space … Read More»

Biological Significance of BST2 Overexpression in OSCC

Overexpression of BST2 is associated with nodal metastasis and poorer prognosis in oral cavity cancer ABSTRACT Objective: Bone marrow stromal cell antigen 2 (BST2) was one of the proteins which were found related to tumor metastasis in our previous proteomic study. Now we want to examine its clinical role on the oral cavity squamous cell carcinomas (OSCC). … Read More»

Impact of Climate Change on Moose Numbers

Moose in the Noose? From Montana to Minnesota, Ontario and Wyoming to Hew Hampshire moose numbers are in steep decline. Could climate change be to blame? These majestic animals, which can be over 6 feet tall and weigh 700 kg, are a highlight for wildlife enthusiasts visiting America’s northern states and bring in much needed … Read More»

Literature Review on Butea Monosperma (Lam.)

LITERATURE SURVEY Butea monosperma (Lam.) Taub. (Fabaceae) 1. Botanical synonyms Butea frondosa Koenig ex Roxb; Erythrina monosperma Lamk. 1.2. Common names Bengali: kinaka, palas, paras, polashi; English: flame of the forest; Gujarati: kakria, kesudo, khakara, khakharo, palasso, phullas; Hindi: chinchra, dhak, palas, paras; Kannada: brahmavriksha, mathuga, mutthugada mara, muttuga, palasa, plashu, thoras; Malayalam: brahmavriksham, mukkappuyam, palas, palasin samatha; Marathi: … Read More»

Do Meal-worms Prefer the Dark? Experiment

Joseph, Jesse, and Hannah Biology-0/1st Behavior Lab- Mealworms Introduction: Mealworms, scientifically known as Tenebrio molitor, are the brown and white colored worm-like larvae of the darkling beetles. They go through a life cycle of transforming from larvae into pupa and then finally into adult darkling beetles. Mealworms are typically found near their food sources (both organic … Read More»

Strategies of Gene Sequencing

Databanks When a gene is sequenced for the first time, it is submitted to a databank such as DNA Data Bank of Japan (DDBJ), GenBank or European Molecular Biology Laboratory (EMBL). The submission of the nucleotide sequence databanks via the internet, undergo a simple automatic process which done electronically with web-based procedures. The databanks that … Read More»

Applications of Probiotics

Probiotics: A Biotherapeutics Application of Potentially Beneficial Microorganisms Vandana Bharti*, Archana Mehta, Siddharts Singh and Neha Jain, Shuchi Mehta   ABSTRACT The term “Probiotics” comes from the Greek word “pro bios” meaning “for life”. Use of Probiotics are not a new invention but it has formed a vital part of diets for thousands of years, … Read More»

Methods of Pest Control for Crop Productivity

CHAPTER 2 LITERATURE REVIEW Crop productivity is highly affected by the presence of pests. Insect pests are one of the major causes of low agricultural yield worldwide (Ferre et al., 2008). In spite of the crop protection measurements, large number of crop is lost to insect pests attack (Oerke, 2006). For sustainable agricultural production to meet … Read More»

STAT-3 and the Invasion of Cervical Cancer Cell Relationship

CHAPTER 1 INTRODUCTION Cervical cancer is one of the most highly leading cancers among the women in the world. The estimated number of cervical cancer cases and death in the world is increase to 527,624 and 265,653 respectively in year 2012 (Saranath & Khanna, 2014). This statistic had influenced the society to be more aware … Read More»

Impact of Human Population Growth

The Growth of the Human Population Chris Long   Since the worlds origin we have seen a steady growth in the worldwide population. From the first records of humans on this earth we have seen the cycle of birth and death. The population increases and decreases are determined by the number of births compared with … Read More»

Major Discoveries in Modern Biology

Emily Faulkner BIOLOGY is a major branch of science that deals with the living organisms. Many discoveries are emerged in this area and the focus of this paper is on major discoveries of modern biology in the field of DNA, biotechnology and cell biology. Cell Biology Nature Cell Biologywas proposed 10 years ago to give … Read More»

Relationship Between Exercise and Reaction Time: Research

EXERCISE AND REACTION TIME RESEARCH QUESTION: How, and to what extent, do varying intensities of aerobic exercise affect the visual and auditory reaction times of males between ages 15-20? INTRODUCTION: The field of reaction time has been one with much interest and study over the past few years, especially given its pertinence and applicability in … Read More»

Genetically Inherited Diseases: Gaucher’s Disease

Nikita Mountford   1. what is a genetically inherited disease? Genetic disorders are typically inherited (passed down) in either a dominant or recessive way. We each have two copies of every gene on our 22 numbered chromosomes. When a disorder is dominant, the disease can occur when there are DNA mistakes in only one of … Read More»

Anti Cancer Activity of Some Novel Quinazoline Derivatives

Abstract At present, the criteria used to select finest novel anticancer drug candidates include inhibitors of cell proliferation, necessary reaction and pathways in cancerous cells. In silico advance resulting in the identification of essential reactions and pathways spreads across several parts of metabolism. The aim of our study is to study the interaction of quinazoline … Read More»

The DebaPhosphoglucose Isomerase (Pgi) Locus in Butterfly Populationte on GM Crops

The Debate on GM Crops  PRINT Benjamin Killick Modelling the evolution of the phosphoglucose isomerase (Pgi) locus in butterfly metapopulations: project proposal. Background: Metapopulation theory, as developed by R. Levins in 1969, concerns the dynamics of metapopulations, which consist of several distinct local populations that exhibit some degree of interaction and occupy isolated areas of suitable … Read More»

In-vitro Study of Hexane Fraction of P. Niruri Whole Plant

Effect of hexane fraction of P. niruri on glucose uptake in L6 cells: Figure 79 represents the effect of hexane fractions of P. niruri whole plant, insulin and metformin on glucose uptake by L-6 myotubes. It is evident from the results that hexane fraction of P. niruri caused increases glucose uptake in concentration dependent manner in L6 cells. The hexane fraction … Read More»

Transferability of Simple Sequence Repeat (SSR) Markers

Transferability of simple sequence repeat (SSR) markers developed in red clover (Trifolium pratense L.) to some Trifolium species Abstract Microsatellite markers previously developed for red clover (Trifolium pratense L.) were used in cross-amplification tests of eight other Trifolium species. Of the 20 SSR loci tested, 9 (47.37%) had positive results and were found to be transferable to all eight species tested. The number of … Read More»

Effect of Oxygen and Oxidative Stress on Ageing

Critically discuss the research evidence that oxygen and oxidative stress are responsible for ageing For decades there have been hundreds of hypotheses regarding theories of ageing (finch). Most of these ideas have been disregarded and several theories now captivate much research on ageing. Random damage secondary to free radicals (FR), notably, reactive oxygen species (ROS), … Read More»

Relationship between Amyloid-/I and Oxidative Stress

Oxidative stress increases amyIoid-~production, and, conversely, amybid-/ I increases oxidative damage. To address the relationship between amyloid-/I and oxidative stress in vivo, we examined, using an array of oxidative markers, transgenic mice that overexpress amyloid-/3 precursor protein and, as in Alzheimer’s disease, develop characteristic amyloid-/3 deposits within the brain parenchyma. Transgenic animals show the same … Read More»

Bacterial Transcription Initiation

YONG YA FEN What are the mechanisms of bacterial transcription initiation? The transcription initiation is dependent on the interaction between RNA polymerase and promoter. The way that RNA polymerase interacts with promoter determines the direction for transcription because it decides which DNA strand to be the template strand and the site where transcription begins (Russell, … Read More»

Cell Culture for Producing Influenza Vaccines

Cell Culture: an Alternative Method for Producing Influenza Vaccines Layth Abdul-Majeed Abdul-Khaleq   Importance of the field: Cell culture-based method for influenza vaccines production offers various advantages over egg-based manufacturing method during influenza pandemics. Areas covered in this review: Benefits of cell culture-based method for influenza vaccines production have been discussed, including: Increasing vaccines production capability during … Read More»

Morphological Characterization of Aromatic Pickle Mango

Morphological Characterization of a few Farmers’-Identified Unique Aromatic Pickle Mango varieties of the Central Western Ghats Manohar Sunagar, Vasudeva R, Bhuwon R. Sthapit and V. Ramanatha Rao   Key words: Aromatic pickle-mango, morphological characterization, descriptors, farmers varieties Abstract Aromatic pickle mango (locally called appemidi and GI tagged) is a special type of pickle mango harvested and semi-domesticated from … Read More»

Effects of Tai Chi on Bone Mineral Density

The Effects of Tai Chi on Bone Mineral Density in Postmenopausal Women: A meta-analysis of RandomizedControl Trials Running title: A meta-analysis of Tai Chi and BMD Highlights: This was a meta-analysis of randomized control trials. A total of 6 articles involving 182 interventions and 168 controls were included. Meta-analysis of BMD at lumbar spine showed no heterogeneity. Attrition bias, reporting bias and other bias of the … Read More»

Correlation of Phenotypic Traits in Maize Different Hybrids

Evaluation correlation between phenotypic traits in corn hybrids and their change trends under drought stress and non-stress conditions at flowering and grain filling stages Rahim mohammadian,Behnam tahmasebpour, Peyvand Samimifar,Habib Lotfi Abstract To investigate the correlation of phenotypic traits in maize different hybrids, an experiment was conducted in split plot design with 3 replications under stress-free conditions and irrigation … Read More»

Analysis of Rat Pancreatic Islets

Discussion We here report, for the first time, that rat pancreatic islet cells and the rat INS-1 β-cell line express detectable levels of transcripts encoding the key enzymes of the TKP. Importantly, this is associated with the spontaneous release of significant levels of the TKP metabolites KYN and KYNA by the rat islets, therefore suggesting some degree … Read More»

Metabolic Pathways of Galactosemia

An Overview of Galactosemia and Its comparison to Electron Transport Chain and Medium Chain Acyl-CoA Dehydrogenase Deficiency Yu Shang Any deficiencies of the enzymes in a metabolic pathway will likely lead to a metabolic disorder. Galactosemia is an autosomal recessive disorder of galactose metabolism.1 The disease is caused by the deficiency in galactokiase (GALK), galactose-1-phosphate uridyltransferase … Read More»

Quantified Amount of Beta Carotene from Galiella Sp

Chapter IV PRESENTATION, ANALYSIS AND INTERPRETATION OF DATA This chapter presents the results on quantified value of beta – glucan and beta – carotene from Galiella sp. extracts. Analysis of beta – glucan contents Table 1. Quantified amount of beta – glucan from thallus The table shows the mean of three trials and general mean as quantified value of … Read More»

Chemistry of Contraceptives

Chapter 3 REVIEW OF LITERATURE 3.1 Norethindrone Norethindrone is 17α-ethinyl-17β-hydroxy-4-estren-3-one. It is also known by its chemical names like norpregneninolone and norethisterone. It is commonly used in some combined oral contraceptive pills, progestogen only pills and is also available as a stand-alone drug. It is white to creamy white in color, odorless, non-hygroscopic, crystalline powder. Norethindrone was the … Read More»

Bamboo as a Source of Phytosterols

Functional foods containing phytosterols are now available in the form of margarines, spreads, baked products, meat, soups and salad dressings. Present sources of phytosterols are limited being derived from vegetable oil and tall oil, a by-product of paper production from wood, and it is estimated that 2500 tons of these oils need to be refined … Read More»

Biological Effects of Smoking on Health

Kim Rissario A report into the biological effects of smoking on health Cigarette smoke is composed of over 4000 different chemicals, many of which are extremely toxic. Cigarettes consist of the following components; tar, nicotine and Carbon Monoxide (CO), which are hazardous to our health. The tar settles in the lungs and stimulates a series … Read More»

The Ethics of Human Enhancement

Bor Shin Chee Human Enhancement The term ‘human enhancement’ embraces a range of approaches to improve aspects of human function such as memory, hearing and mobility to improve human performance, hence raising these function to a level considered to be beyond the existing human range. Human enhancement categorized into particular areas: life extension, physical enhancement, … Read More»

Extraction of Antioxidant Compounds From Lichens

Efficient method of extraction and separation of antioxidant molecules from Lichens obtained from Kolli hills of Tamil Nadu Abstract Lichens are made by symbiotic association of both fungi and algae. The fungi was found to be the major partner and in the metabolite production too. The lichen metabolites were found to be very unique compared … Read More»

Pluripotent Stem Cells: Benefits, Properties and Uses

INTRODUCTION Pluripotent stem cells give rise to nearly all cells types of the body, like, muscle, nerve, heart, and blood. They hold huge promise for both research & health care. The advance in human biology continues to generate interest among scientists, patients suffering from a wide range of diseases, including cancer, heart disease and diabetes, … Read More»

Development of the Bio-Chemical Sector in the UAE

Saman Masood BIO-CHEMICALS: The term ‘bio-chemical’ comprises of two words, that is, ‘bio’ which means ‘life and ‘chemical which means any ‘chemical substance’ that arises from a chemical compound which makes up a living cell. There are number of bio-chemicals which can be obtained from various sources, for example, proteins from beef pancreas, plants and … Read More»

Effect of Different Substrate and Temperature on Yeast

background information introduction to cellular respiration Cellular respiration is the catabolic process of converting the chemical energy stored in chemical bonds into energy in the form of adenosine triphosphate ATP. Adenosine triphosphate is a high energy molecule, used in cells as a “molecular unit of currency” of intracellular energy transfer(Bergman, J 1999). Cells are capable … Read More»

Alzheimer’s Disease and Calcium Signalling

The pathogenesis of Alzheimer’s disease is complex, and involves many molecular, cellular and physiological pathologies. The leading candidate for the trigger of Alzheimer’s disease is the Aβ peptide,which is produced by the proteolytic processing of the amyloid precursor protein (APP; BOX 1). Its primacy has been manifested in the ‘amyloid-cascade hypothesis’,which posits that the accumulation … Read More»

Analysis of Nilaparavata Lugens (Stal.)

Nilaparavata lugens (Stal.) Nilaparvata lugens is generally called as brown plant hopper or Asian rice brown plant hopper (BPH). N. lugenscomes under order: Hemiptera, Suborder: Auchennorrhyncha and Family: Delphacidae. The delphacid genus Nilaparvata consists of 18 species. Nilaparvata is a crucial genus economically, with one amongst its member N. lugens being serious insect pests of rice and are cosmopolitian particularly in tropical Asia wherever … Read More»

Role of Cell Signalling in Regulation of Homeostasis

NEHA HITENDRA RANE Introduction What is Homeostasis? Homeostasis is the ability to maintain a constant internal environment in response to environmental changes. Homeostasis is a ability to maintain relatively stable internal conditions even though there is continuous change in outside world. The term homeostasis is derived from the two Greek words homeo and stasis. Homeo which means unchanging … Read More»

Impacts on Population Growth

Submitted By MUHAMMAD BILAL   Contents (Jump to) 1. POPULATION 2. POPULATION GROWTH WITHOUT ANY REGULATION 2.1 BIOTIC POTENTIAL 2.2 EXPONANTIOAL GROWTH EXAMPLE 2.2.1 ASSUMPTIONS OF EXPONENTIAL GROWTH 2.2.2 APPLICATIONS OF THE EXPONENTIAL MODEL 3. POPULATION REGULATION 3.1 EXTRENSIC FACTORS 3.1.1 ABIOTIC FACTORS 3.1.2 BIOTIC FACTORS 3.2 INTRINSIC FACTORS 4. DENSITY INDEPENDENT FACTORS 4.1 CLIMATE … Read More»

Pink Disease of the Rubber Tree: Causes and Effects

INTRODUCTION The rubber tree is the most important source of natural rubber. It is constantly under threat from various pathogens that cause severe diseases like abnormal leaf fall, Corynespora leaf disease, brown root disease, and pink disease and Colletotrichum leaf disease. Leaves alternate, palmate and each leaf with 3 leaflets. Leaflets elliptic petiolated, with a … Read More»

Production of Mutant Based Epsilon Toxin (ETK) Vaccines

Critique of Li et al. Article: A low-toxic site-directed mutant of Clostridium perfringens É›-toxin as a potential candidate vaccine against enterotoxemia Name: Donnelle Phillips Vaccines improve the immune system of an animal or human by stimulating the production of antibodies to fight and combat bacteria, protozoan or viruses effectively creating immunity against disease (Salisbury 1997). Vaccines … Read More»

Annotated Bibliography: Bt Cotton Studies

LITERATURE REVIEW Tabashnik et al. explained that using transgenic crops such as Bt cotton could significantly reduce the use of chemical insecticides and pesticides. They also pointed out that excessive use of transgenic crops initiated the development of resistance in pests, which must be delayed. They suggested the use of two different Bt toxins to target … Read More»

Risks to the Human Population

Human Populations are at Risk from outbreaks of New Diseases Diseases are the disturbance of body processes impacting homeostasis, the emergence and resurgence of diseases is majorly dependent on social, ecological and geographical change rather than the molecular or microbiological aspects (Mayer, 2000). This essay will cover the growing evidence that climate change poses health … Read More»

The Future for Clinical Immunology

A.N. Other (SID ), Department of Pathobiology, University of Turku, Finland. The last ten years has seen a tremendous increase in our understanding of the molecular basis of different disorders. clinical immunology is a specialism which is currently developing in different ways, some of which are highlighted here. This discipline has a responsibility to provide … Read More»

Exogenous IL-10 and Golimumab for Heart Failure Treatment

Synergistic Effect of Exogenous IL-10 and Golimumab in the Treatment for Heart Failure in Rats Running title: Heart Failure Treatment Highlights: The level of TNF-α decreased after treatment with IL-10 and golimumab. The level of IL-10 was increased by IL-10 combined with golimumab. IL-10 and golimumab have a synergistic effect on HF in rats. ABSTRACT Objectives We attempted … Read More»

Multi-slice Computer Tomography (MSCT) Analysis of Nodules

Multi-slice Computer Tomography (MSCT) Analysis of Benign and Malignant Nodules in Patients With Chronic Lymphocytic Thyroiditis Highlights MSCT features is useful in differentiate the benign and malignant nodules in CLT patients. MSCT is superior than plain CT scan in nodule diagnosis in CLT patients MSCT may apply as an important diagnostic modality in the clinical … Read More»

Poultry Diseases: Impact, Types and Causes

Introduction: Poultry diseases had made an adverse effect on the industry during past few years. The data and studies related to the impact of poultry diseases and their prevalence is still not enough. The interpretation, forecasting of poultry diseases and their epidemiological analysis is very important at national and international levels. The monitoring of production … Read More»

Diversity of Fungal Endophytes in Cymbopogon Caesius

Diversity of Fungal Endophytes in Cymbopogon caesius (Hook. & Arn.) Stapf. of Kemmannugundi Regions of Karnataka, India Avinash K.S. and Y.L. Krishnamurthy*   Abstract: Cymbopogon grass produces many bioactive compounds and used for many medicinal purposes. In this study healthy leaf, stem and root segments were cultured on media like Potato dextrose agar and Malt extract agar medium … Read More»

Incidence of Mycoflora in Spices

Incidence of mycoflora associated with some spices Hedawoo GB, Mishra SA and Maggirwar RC   Abstract: Black pepper, fennel and cumin are extensively used as spices in India. Seed pathogens adversely affect the production and quality of spices. The mycoflora associated with spices not only deteriorate the quality of spices but also increase the chance of … Read More»

Identification of Fatty Acids in Launaea Procumbens

Identification of fatty acids in leaves and roots of Launaea procumbens by GC-MS and assessment of flavonoid and phenolic content and antioxidant activity This study presents an analysis of fatty acid composition of in root and leaves of Launaea procumbens by GC-MS and hexane extract were studied for the determination of total flavonoid and phenolic content along with scavenging … Read More»

Cocaine: Properties and Effects

Cocaine is a drug refined from Erytroxylon cocoa bush leaves which grows in Peru and Bolivia. It is referred to using several names such as C, snow, flake, blow, or crack. Generally, it is sold on the streets as a hydrochloride salt. It has a fine, white crystalline powder appearance usually diluted with resembling substances … Read More»

Relationship Between Serum Folate Level and Cervical Cancer

The association between serum folate level and cervical cancer: a meta-analysis Abstract Objectives: This study is to evaluate the association between serum folate level and cervical cancer. Methods: PubMed, Medline, Springer, Elsevier Science Direct, Cochrane Library and Google scholar was searched for relevant trials. Rev.Man5.1 and Stata 11.0 software were applied for the meta-analysis. Odds Ratio (OR) and 95% confidence … Read More»

Effect of Steroid Sulfatase (STS) on Sex Selective Disorders

Introduction The inner workings of the body are amazing. Through evolutionary time and random chance, proteins used in one area of the body become crucial in others. It would seem very unlikely that one enzyme would be responsible for proper brain function AND proper skin maintenance, because the two areas seem different in terms of … Read More»

Aspergillus Fumigatus Identification and Molecular Character

IDENTIFICATION AND MOLECULAR CHARACTERIZATION OF Aspergillus fumigatus FROM SOIL R.V.Shalini, and Dr.K.Amutha,   ABSTRACT: Soil was collected, serially diluted and pure culture obtained; slant was prepared in potato dextrose agar and maintained throughout the study. Morphological, microscopical and macroscopically identification were carried out on the isolated organism. DNA was isolated from the 24 hour culture, for ITS-PCR amplification. … Read More»

Developing Groundwater Sources in the UAE

ABSTRACT We all know that UAE is located in the desert where there is only limited sources of underground water, little rain and no rivers. This is the main problem that UAE government facing today having water shortage. That’s why UAE rely in some water sources like desalination of sea water, Groundwater, Surface water and … Read More»

Metabolism of Insulin: An Analysis

The metabolism of insulin and DDI between insulin and several anti-diabetes drugs Zhe Li In this paper, I am going to study the metabolism of insulin in human body and briefly introduce the drug-drug interactions between insulin and some anti-diabetes drugs. In the first part of the paper, I will introduce background information of insulin. … Read More»

Epidermolysis Bullosa: Mutations of Type VII Collagen Gene

A novel deletion mutation and two recurrent substitutions on type VII collagen gene in seven Iranian patients with epidermolysis bullosa Armita Kakavand Hamidi, Mohammad Moghaddam, Nasim Hatamnejadian, Bahar Sedaghati Khayat, Ahmad Ebrahimi   Abstract Epidermolysis bullosa is one of the most important series of mechano-bullous heritable skin disorders which is categorized into four major types … Read More»

Differences between Eukaryotic and Prokaryotic Cells

Prokaryotes are a group of mostly unicellular organisms which do not have a membrane bound nucleus; they are made up of two main groups, the archaea and the bacteria. Eukaryotes on the other hand are mainly multicellular with a membrane bound nucleus, and are broken done into four main kingdoms; animals, plants, fungi and protoctista. … Read More»

In Vitro Activity of Malia Azedarach Linn

In vitro activity of Malia azedarach Linn. Against amphotericn B resistant Leishmania tropica strain Abstract Cutaneous leishmaniasis is still a big health problem around the world and drug resistance has emerged as a major problem in treatment. The purpose of the study was to generate Amphotericin B resistant strain and evaluate the crude extract of Melia azedarach against wild and lab … Read More»

Biodegradation of Profenofos Using Fungal Isolates

Dr. Jayanthi Abraham*   Anjali.M, Caroline Jessica Solomon, V.Vinothini.   Abstract Biodegradation is a sustainable and eco friendly way to clean up contaminated environments. The biological processes harnessed play a major role in the removal of contaminants and they make use of the catabolic versatility of microorganisms to degrade/covert compounds which are toxic and difficult … Read More»

Analysis of Phytocompounds in Spathodea Campanulata Leaves

Experimental and Computational analysis of Phytocompounds in Spathodea campanulata leaves Priyanka Pattnayak, Pankhuri Tiwari,   Shanthi V.   Abstract: Spathodea campanulata (Fountain Tree) has several remedial uses. The bark has antiseptic properties and can be used as a laxative and its other parts like roots, seeds and flowers also have medicinal uses. The leaves of Spathodea contain iridoids, flavonoids and phenylpropanoids; classes of plant … Read More»

Scanning Electron Microscopy on Silk Mesh Network

4.1 SEM of Silk Scanning electron microscopy was performed on dialyzed complete chain (degummed silk fraction), soluble silk (light chain) and Insoluble silk (heavy chain). On SEM imaging of complete silk mesh network of silk fibers was observed, but, on separation of silk fibers no such fiber network is observed which shows complete separation of … Read More»

Hyaluronic Acid in Pharmacology and Drug Delivery: A Review

Introduction Hyaluronic acid (HA), also known as hyaluronan, is a naturally occurring biodegradable mucopolysaccharide that is found in mammals, bacteria, and most types of organisms. Hyaluronic acid has many biological functions, such as influence of cell differentiation and proliferation, regulation of cell adhesion and motility, as well as giving tissues various biochemical properties. HA also … Read More»

Intestinal Parasites in Wild Rates

Introduction Mauritius is a small island of 1865 km2 situated 900 km east of the Malagasy Republic in the southern Indian Ocean. The island was found to be suitable as a port of call for traders travelling along the famous Spice Route from Europe round the Cape of Good Hope to the East Indies and was … Read More»

PD-targets for Voriconazole and Posaconazole

Based on the estimates of the PD-targets for voriconazole and posaconazole we can now determine if there remains a role for voriconazole or posaconazole in the management of azole-resistant disease. The integration of all above information is given in Table 5 for voriconazole and Table 6 for posaconazole. The underlying resis- tance mechanisms are provided … Read More»

Reducing Levels of Diacetyl in Saccharomyces Pastorianus

A critique of approaches to understand and reduce levels of diacetyl in saccharomyces pastorianus Michelle Aherne Section 1: Background and Context Diacetyl is a vicinal diketone (VDK), produced as a by-product of intermediates in the valine biosynthetic pathway of yeast lager stains (Krogerus and Gibson, 2013b). It causes an unfavourable butterscotch flavour (Gibson et al., … Read More»

Shotgun Metagenomics of the Human Stomach

Materials and Methods Biopsy samples Four fresh biopsy specimen taken from stomach. Two from antrum and two from the body. One biopsy from each side was stored in liquid nitrogen and another piece was used for the culture. For culturing, the fresh biopsy tissues was homogenized and simultaneously inoculated onto selective plates [5% horse blood … Read More»

Homeostasis, Co-ordination and Control and Excretory System

Stanley Agu   TAQ 1 Homeostasis is a term translated from the words Homeo meaning ‘’same’’ and stasis meaning ‘‘standing still’’. This term simply describe a dynamic state of equilibrium and the ability of the body to maintain a stable internal condition with a changing outside environment. This process is used to maintain and regulate body temperature, blood sugar … Read More»

Spasmolytic Activity of Calotropis Procera In Rabbit Jejunum

In-Vitro Study on Spasmolytic Activity of Calotropis Procera In Rabbit Jejunum Authors:, Dr Jagadeesh K, Dr Shreenivas Revankar, Dr Jagadeesh S C.   ABSTRACT: In ancient India many herbal plant products were used for their medicinal values. Calotropis procera known as arka, madar, milkweed. It was used as antimicrobial, anti-fertility, anticancer, leprosy and antihelmintic. In the … Read More»

Determination of Heavy Metals in Pigeon Feathers

DETERMINATION OF HEAVY METALS IN PIGEON FEATHERS IN THE DIFFERENT AREA OF AJMER CITY. Rajeshwari Acharya and Asha Sharma   ABSTRACT Metal determination using pigeon feather is most common method of biological monitoring for screening, diagnosis and assessment of mental exposure and its risks. Pigeon feather were collected from different area of Ajmer city of … Read More»

Effect of Benzodiazepine Addiction on Genomes

BIO621 – GENETICS AND GENOMICS RESEARCH PROPOSAL Submitted By: Rabia Iftikhar Submitted to: Dr Aziz Mithani Date: 25th May, 2015 TITLE OF PROPOSED PROJECT Genome wide study of transcriptional and epigenetic changes induces upon addiction to benzodiazepine and their inheritance. RESEARCH AREA Pharmacogenetics PROJECT DIGEST Some drugs that are available over the counter as well as … Read More»

Impact of Haemolysis in Accuracy of PT/APTT

Topic: Impact of haemolysis in accuracy of PT/APTT (Important of fast and accurate PT/APTT results in managing patients) CHAPTER 2: LITERATURE REVIEW 2.1 PT and APTT Theprothrombin time(PT) and its derived measures ofprothrombin ratio(PR) andinternational normalized ratio(INR) are measures of the extrinsic pathway of coagulation [3, 7]. They are used to determine the clotting tendency of blood, in the measure … Read More»

Effect of pH and Temperature: Enzyme Catalase Reaction Rate

The effect of pH and temperature on the reaction rate of the enzyme catalase INTRODUCTION Enzymes are proteins produced by living cells that act as catalysts during a reaction, meaning they lower the activation energy needed for that reaction to occur. Activation energy is the amount of energy required to start a chemical reaction. In … Read More»

Ecosystem Based Management

Marine environments are complex adaptive systems adjoined across multiple scales by ocean currents and species movements (Ruckelshaus et al 2008). These ecosystems worldwide are in serious decline, primarily as a result of broadening anthropogenic pressures that exploit marine resources such as shipping, energy exploration, fisheries and tourism (MA 2005; Curtin et al 2010), which can … Read More»

Oxygen Consumption By Different Animals

  Name & Matric No. Calvin Belulok Ngang 40754 Malinka Anak Sikim 41989 Philovenny Anak Pengiran 43733 Brenda May Engkian anak Nandong @ Sulie 40747 Christ Hani binti Lian Lee 40907 Racheal Anak Rosedy 43768 Hilda Jelembai Anak Nelson Ilan 41423 Muazzah Bt Abd Latif 42327 LABORATORY 2 INTRODUCTION There are two types of respiration … Read More»

Harmful Effects of Dyes and Additives

Bella Zavlanova Bioresearch Professor Schiffenbauer DO FOOD ADDITIVES/ DYES CAUSE HARM TO CONSUMERS? The objective of this paper is to find out if dyes and additives such as red 40, yellow 5, yellow 6 and blue 2, which are added to foods, drugs, and cosmetics, are harmful to the consumers? Do we really believe these … Read More»

ERG11 in Drug-resistant of C. Krusei

Erg11 mutations and up-regulation in clinical itraconazole–resistant isolates of Candida krusei Some C. krusei isolates were resistant the antifungal drugs. Mutations including T939C, T642C and A756T were found in ERG11 of C. krusei. ERG11 was highly expressed in resistant C. krusei strains.. Abstract Objective We aimed to provide with light for better understanding of ERG11 gene in drug-resistance mechanisms in Candida krusei (C. krusei). Methods C. krusei strains were isolated from patients in the Dermatology … Read More»

Effect of Serratia Marcescens Pilli on Red Blood Cells

INTRODUCTION. The aims of the investigation are to identify the effect of bacteria, for example, what effect can Serratia marcescenspilli on red blood cells gives when mixed with molecular inhibitor. Also, to examine how pathogenic bacteria for example Clostridium perfringes produce toxin and what effect does toxin have on cells. In addition to the above, to examine the … Read More»

Relationship between Genetics and Prostate Cancer Risk

Abstract Purpose: Prostate cancer (PCa) is one of the most commonly diagnosed male malignancies. Numerous studies have investigated the role of genetic variants in PCa risk. However, the results remain unclearly. The purpose of this study was to evaluate the relationship between rs2228001 in XPC, rs4073 in IL8, and rs2279744 in MDM2 with PCa susceptibility. Materials and Methods: Electronic database of … Read More»

Molecular Causes of Postmenopausal Osteoporosis (PMOP)

Abstract Purpose: We aimed to explore the molecule mechanism underlying postmenopausal osteoporosis (PMOP) and smoking-related PMOP. Methods: The microarray data of GSE13850 was downloaded from Gene Expression Omnibus (GEO) database. The differential expression genes (DEGs) between high and low bone mineral density (BMD) samples (DEG1) and postmenopausal female smokers with high and low BMD (DEG2) were analyzed. … Read More»

UCA1 in Cisplatin Induced Ovarian Cancer Cell Resistance

The Expression of Long Non-coding RNA UCA1 in Human Ovarian Cancer Cells and Its Role in Cisplatin Cytotoxicity in Vitro Running title: UCA1 in cisplatin induced ovarian cancer cell resistance Highlights Increasing expression of UCA1 RNA was found in ovarian cancer tissues. UCA1 can increase the cell migration, invasion and cisplatin resistance. The effect of UCA … Read More»

Causes of Nephrogenic Diabetes Insipidus (NDI)

Introduction During the past two decades, significant and advance scientific researches in molecular biology and genetics have set the stage for a revolution in medical science. Advance researches in gene cloning, gene mapping and mutation study have contributed to an explosion of new information regarding the fundamental biological and patho-physiological basis for hundreds of human … Read More»

Developing Immunology in Pregnancy

Immunology of Pregnancy (In human context) ABSTRACT: Nowadays there are cases of infertility, preeclampsia and recurrent abortions. For treating these problems it is important to gain knowledge of complex mechanism underlying pregnancy. These mechanisms are studied in the field of reproductive immunology. Immunology of pregnancy is not fully understood due to its complexity, yet a very … Read More»

Analysis of Cotton Growing in India

Abstract Important cash crop in India is Cotton. India is second largest producer of cotton after China and grown on twelve million hectares. Currently in India only Insect resistant Bt cotton is grown. Remarkable growth has been seen in production and cultivation of Bt cotton in India. This growth is seen with introduction of Bt … Read More»

Analysis of Monthly Values of Magnesium in Water

Magnesium: Magnesium is required universally by chlorophyllus plants as the component of chlorophyll molecule. Magnesium is associated with calcium in all kinds of water but its concentration remains generally lower than the calcium (Venkatsubramani and Meenambal, 2007). It is a main cation causing water hardness. In natural water magnesium comes from natural processes i. e. … Read More»

Welfare of Animals at the Time of Slaughter

Matthew Indge Animal Welfare Assignment 2: Literature review The Welfare of Animals at The Time Of Slaughter Abstract Introduction Animal slaughter is one of the most key processes in gaining food for many human beings. In many countries such as the US and Europe there are strict regulations on the Slaughter of animals (Nakyinsige et al., … Read More»

Thermophilic Bacteria and Psychrophilic Bacteria Analysis

DISCUSSION Sikkim lies in The Great Himalayan Range, which is considered as a relatively young range of mountains in the world. Sikkim is also regarded as a hot spot having huge diversity in flora, fauna and microbial community. Sikkim has several hot springs; however, till date no systematic studies have been conducted on these hot … Read More»

Synthesis of Structure Based Vaccine Against Hepatitis C

  C1.RESEARCH AREA Molecular Biology, Bioinformatics and Biochemistry D.PROJECT DIGEST HCV is very common infectious disease all around the world (180 million people effected per year) and in Pakistan too and is a cause of chronic liver hepatitis C. It’s a small virus containing RNA as a genetic material. Over the course of evolution this … Read More»

Diagnosing Diseases from Ancient Human Tissue

Introduction The pathogenesis of human diseases has been further understood based on findings in the study of ancient populations across thousands of human history [1]. The premise of these work is the diagnosis of ancient diseases [2]. With the progress in biology and medicine, archaeologists and palaeopathologists can obtain a great deal of biological information … Read More»

Streptococcus Mutans: Causes, Effects and Transmission

Introduction Streptococcus mutans is the bacteria responsible for dental cavities in humans. The full taxonomy, or classification of the organism, is Bacteria Firmicutes Bacilli Lactobacillales Streptococcaceae Streptococcus Mutans (1). From S. mutans’ scientific name one can understand quite a bit about the bacteria. The domain and kingdom are Bacteria, meaning S. mutans is a one celled organism that doesn’t have a distinct … Read More»

Rheumatoid Arthritis Treatment Methods

INTRODUCTION Autoimmunity is the inability of an organism in recognizing its own parts asself, which triggers an abnormal immune response against its own cells or tissues. Due to such a response, autoimmune diseases occur. Autoimmune diseases are broadly divided into the following: Systemic autoimmune diseases: The symptoms and damage occurs throughout the body, i.e the antigen is … Read More»

Random Amplified Polymorphic DNA (RAPD) Analysis of Agarwood

1.0 Introduction Agarwood is considered as the most expensive wood in the world which can be derived mostly from genera Aquilaria and Gyrinops from the family Thymelaeaceae (Akter, Tanvir, Zulkefeli, & Khan, 2013). According to Subasinghe, Hettiarachchi, and Rathnamalala (2012), some of the species from the Aquilaria and Gyrinops can be found across at least 12 countries including Bangladesh, Bhutan, Cambodia, India, Indonesia, Lao PDR, … Read More»

Spatial Learning Ability of Male and Female Mice in Mazes.

PREPARED BY: ELANCHELIAN A/ L THEVER116637 FARAH HANI BINTI MUNJIAT116640 NURUL FATINIZZATI BINTI ABD HALIM116704 LUCIA EMPINA HARRY116650 NURFAZRINA BINTI JAINULABADEEN116685 INTRODUCTION: The house mouse (Mus musculus) is a small mammal of the order Rodentia, characteristically having a pointed snout, small rounded ears, and a long naked or almost hairless tail. House mouse can live … Read More»

Effects of the Lionfish Invasion

Lionfish invasion Should Lionfish be removed? Introduction The lionfish are biological pollutants, they are considered predators and close to the top of the food chain, this makes them dangerous to the ecosystem and humans as they can inflict extremely painful stings. They are currently out-competing native predatory fish such as grupers as well as reducing … Read More»

Expression Levels of Artemis in Taxane-based Chemotherapy

Introduction Although decreasing in most countries, gastric cancer remains one of the most leading causes of cancer death in the world with poor prognosis. Patients with recurrent or unresectable gastric cancer usually have poor outcomes, with 5-year mortality of more than 95% [1]. Diffuse types of gastric cancer are strongly suggested by World Health Organization (WHO) classification … Read More»

Experiment on Characteristics of Invertebrates

Lab 6 – invertebrate diversity Amine A. Harb Introduction Invertebrates are classified in relation to their lack of backbone or spinal column. A few distinguishing characteristics of invertebrates include distinctive respiratory organs, segmentation, radial and bilateral symmetries, and body organization. This experiment required us to dissect and examine an earthworm and a squid. The squid’s … Read More»

Phylogenetic Analysis of Universal Stress Proteins (USPs)

ABSTRACT Resistance to different stress conditions constitutes regulation of many proteins among which Universal stress proteins (USPs) are the most important group of proteins found in plant cells. USPs are reported to be essential in different stress conditions and assigned as conserved domain, were subjected to database search. We found 35 homologs of USP in Arabidopsis … Read More»

Exosomes: Roles and Applications to Cancer

Exosomes (The research behind cancer biomarkers) Afnan Elhag Introduction Exosomes are small vesicles which are found in many body fluids, such as blood and urine (1, 2). Its diameter is between 30 and 100nm, but much smaller than a bacterial cell. Exosomes can be released from the plasma membrane or by multi vesicular bodies fusing with the plasma membrane (3). Specialized … Read More»

Radial Artery Access to Bronchial Artery Embolization

Radial artery access to bronchial artery embolization for massive hemoptysis: a case report Abstract Background: Massive hemoptysis is a potentially fatal respiratory emergency. Bronchial artery embolization (BAE) is commonly applied to treat massive hemoptysis. However, in most cases, BAE was performed via the access of femoral artery. The treatment via the access of radial artery is rare and challenging. Case description: Herein We we reported a … Read More»

Molluscan Assemblage on the Intertidal Zones of Butuan Bay

MOLLUSCAN ASSEMBLAGE (UNIVALVIA AND BIVALVIA) ON THE INTERTIDAL ZONES OF BUTUAN BAY, AGUSAN DEL NORTE, NORTHEASTERN MINDANAO ARIEYL C. JAMODIONG INTRODUCTION Coastal zone is one of the marine environments where the most intense and harsh conditions in the world occurs. This aquatic biome often deals with the changing of tide daily allowing extreme exposure to … Read More»

Impacts of Genetically Modified Food on Health | Literature

Source 1: Genetically Modified Foods Reference Genetically Modified Foods: Harmful or Helpful? April 2000 Written by: Deborah Whitman [ONLINE] Available at: http://www.csa.com/discoveryguides/gmfood/overview.php. [Accessed 19 October 2013] Summary GM foods and crops refer to those plants created for human consumption using the latest molecular biology techniques. The plants have been modified to enhance desired traits such as increased … Read More»

Bioefficacy of New Generation Insecticides

BIOEFFICACY OF NEW GENERATION INSECTICIDES ON Spodoptera litura (Lepidotera: Noctuidae) IN AMARANTH P. M. KRISHNA, T.B. MATHEW Department of Agricultural Entomology, College of Agriculture, Vellayani, Thiruvanathapuram 695022, Kerala, Inida. Email: muralikrishnapooru@ gmail.com ABSTRACT: Spodoptera litura major pest on vegetable amaranth. New generation insectiicdes such as Chlorantraniliprole 18.5 % SC – 0.006 %, Novaluron 10 % EC – 0.015 %, Flubendiamide 39.35 … Read More»

Genetic Causes of Sickle Cell Anemia

Jay Patel Sickle cell anemia is one of the most common disorders which are inherited from a single gene disorder. Usually these disorders have been seen in African-Americans1. Sickle cell disease was first described in 1910 by dental student with pulmonary symptoms. Sickle cell shaped was first known as Herrick coined to describe the peculiar … Read More»

Origin of Multicellular Eukaryotes

The beginning of multicellular Eukaryotes is one of the most important event in earth’s history regarding Eukaryotic life. As we can observe, most if not all animals, plants, and fungi are multicellular Eukaryotes therefore multicellularity is a key component of the early evolution regarding complex life. However, multicellularity nor Eukaryotic cell suddenly occur at once. … Read More»

History of Transgenic Animals

Long before farmers were used selective breeding to enhance economically important trait like growth, milk production, egg production, and etc…consequently, this situation sets the foundation of genetics study that support the study of regulation and function of mammalian genes. The study was either through the observation of inherited characteristics from the parent or the unexpected … Read More»

Amyotrophic Lateral Sclerosis: Improving Treatments

Summary ALS is a progressive, fatal motoneurone disease, ultimately leading to paralysis and respiratory failure within 3-5 years. There is currently only one FDA-approved drug, Riluzole, but its lack of disease prolongation combined with the aggressive disease nature means identifying new treatments is essential. This review highlights 3 of the most current and promising research … Read More»

Role of Taurine Against Toxic Effects of Nanosilver

To evaluate the preservative role of taurine against toxic effects of nanosilver, ovine epididymal sperm were exposed to different concentrations (0.05, 0.2, 0.4 M) of taurine (T) and nanosilver colloid (N) (1 ppm) for 120 min in vitro and then, the viability and motion parameters of sperm were assessed. The percentage of live sperm in … Read More»

The Hutchinsonian and Eltonian Shortfalls

A number of recognized knowledge shortfalls currently exist in biology. The first that appears to have been identified is taxonomical, and is known as the Linnean shortfall (Raven and Wilson 1992). This concerns the disparity between species described by scientists and the actual number of species in the world. The second, the Wallacean shortfall, is … Read More»

Uses of Medicinal Plants: Literature Review

People all over the world use different medicinal plants for curing various diseases and to find a solution to various ailments. India being the home to rich flora and fauna holds the panacea to many illnesses. The branch of ethno botany becomes very relevant here as it gives clear definition as to how the use … Read More»

Acute Nitrite Exposure of Fish Using Common Carp

Acute nitrite exposure of fish using common carp as a model species The acute exposure of carp (Cyprinus carpio L.) to enhanced nitrite concentration at a low molar ratio of Cl–/NO2–(0.21) for 48 hours caused high mortality and increased blood plasma nitrite to concentrations 7 times that of the ambient water. Jensen et al. (1987) observed … Read More»

Evaluation of Purified Extracts of Leptogium Papillosum

INTRODUCTION Free radicals are highly reactive atom having one or more unpaired electron produced from the oxidation reaction that takes place in the transfer of electrons capable of attacking the stable biomolecules. These free radicals initiate cascades of events which ultimately lead to cellular damage [1]. However, physiologically these free radical preserve homeostatic action by … Read More»

Mechanisms of Activation of NFκB Signaling Pathway

Objective: we aimed to analyze the mechanisms of activation of NFκB signaling pathway in the carcinogenesis of LSCC. Methods: Protein array was used to identify the differentially expressed proteins involved in NFκB signaling pathway in 50 LSCC cells compared with 50 cases of normal throat mucosa. Correlation analysis between significantly differentially expressed proteins and clinical … Read More»

Reporter System Using LuxABCDE

La Rosa, S.L., Diep, D.B., Nes, I.F., et al. (2012) Construction and application of a luxABCDE reporter system for real-time monitoring of Enterococcus faecalis gene expression and growth. Applied and Environmental Microbiology, 78 (19): 7003-7011 Reporter genes are the genes encoding a protein which can be tracked and quantified by microscopy and various biochemical assays. They provide a non-invasive and sensitive … Read More»

Genome Study of the Hepatitis C Virus (HCV)

Hepatitis C virus (HCV) is the causative agent of hepatitis C, which is an infectious liver disease of humans. Estimates indicate that 170 million people are chronically infected globally and are at risk of developing liver disease including cirrhosis (scarring of tissue) and liver cancer. Furthermore, 350,000 deaths occur each year due to all HCV-related … Read More»

Article Review: Metformin and Cancer

“Metformin and cancer: from the old medicine cabinet to pharmacological pitfalls and prospects” Review article This essay aims to identify and explain the main points made in the Review article ‘Metformin and cancer…’ and discuss their implications and overall significance in a pharmacological context. Metformin is a synthetic biguanide and the most common prescribed drug … Read More»

Soft Sediment Communities Composition

DISCUSSION 5.1 Comparison of Soft Sediment Communities Composition and Sediment Type from Different Scales Generally, macrobenthic organisms were found in abundance at Tanjung Bungah. Polychaetes have been observed to dominate in muddy area. Bivalves and gastropod were observed to be dominated in sandy area. Rhoads & Young (1970) noticed that sandy substrates tended to be … Read More»

Public Health Issues: Type 2 Diabetes

Abhishek Kumar Is type 2 diabetes a public health emergency? Definition: The term “”diabetes mellitus”” describes a metabolic disorder of multiple aetiology characterised by chronic hyperglycaemia with disturbances of carbohydrate , fat and protein metabolism resulting from defects in insulin secretion , insulin action , or both . The effects of diabetes mellitus include long-term … Read More»

Structure of the Male Reproductive System

New chapter 35 The Male Reproductive System INTRODUCTION The male reproductive system has three principal functions: The differentiation and maintenance of the primary and secondary sex characteristics under the influence of the hormone testos­terone, made in the testes. Spermatogenesis—the creation of the male gametes inside the testes. The penile delivery of sperm from the testes … Read More»

Prioritisation Assessments in Species Conservation

and do not necessarily reflect the views of UK Essays. Are some species more worthy of conservation than others? Due to anthropogenic activities, the present rate of extinction rise is taking place at nearly 1000 times that of then natural background level of extinction observed from the fossil record. Conservation biology traditionally focuses on preventing … Read More»

Experiment on Factors Affecting Enzyme Activity

and do not necessarily reflect the views of UK Essays. May Zheng Lab Partners: Vena G. and Sara W. Observations: Part A: The Effect of Surface Area on Enzyme Activity Table1: Amount of Foam Produced by Potato Samples with Different Sizes Potato Samples Maximum Height of Foam Produced (mm) Large cubes 1mm Small cubes 5mm Crushed … Read More»

Smoking and Alveolar Repair

Lakshmi Mohanadas   Cigarette smoking is one of the major cause for many of the lung diseases. Smoking is a practice of burning a dried plant and inhaling the smoke. It is one of most common form of recreational drug usage. People who smoke, get addicted to smoking which leads to gradual damage to the … Read More»

Early vs Late Reduction of Cervical Spine Injury

and do not necessarily reflect the views of UK Essays. Ghulam Farooq , Alisha Sial OBJECTIVE: To determine outcome of early (<72hours) surgical intervention in subaxial (C3-C7) cervical spine injury through anterior approach among adults. OPERATIONAL DEFINITION Primary Outcome: The ASIA impairment scale is a validated tool to describe a patient’s functional impairment as a result … Read More»

Study of Anti-cancer Potential of Dodoneine

PROJECT PROPOSAL Anju Angel James Title of the project:Comparative study of anti-cancer potential of Dodoneine and its derivative. SUMMARY : Dodoneine [(R)-6-[(S)-2-hydroxy-4-(4-hydroxyphenyl)butyl]-5,6-dihydropyran-2-one] is a naturally occurring dihydropyranone which is isolated from Tapinanthus dodoneinfolius DC Danser, also known as African mistletoe. Tapinanthus dodoneinfolius is a parasitic plant that feeds from the sheanut tree in Burkina Faso. The unique, challenging structural and functional … Read More»

In Vitro Estimation of Th1/Th2 Cytokines by ELISA

Study of mechanism of Action of S012-0975:  In vitro estimation of Th1/Th2 Cytokines by ELISA: A drug like candidate should have the properties to completely eliminate the parasite either through activation of macrophages or by directly acting on parasite. Cure in visceral Leishmaniasis is observed by the production of Th1 cytokines, IFN-γ, IL-12 and TNF-α and enhanced … Read More»

Nasonia Vitripennis and Nasonia Giraulti Memory Analysis

Formation and retention memory : a comparison between Nasonia vitripennis and Nasonia giraulti 1 Introduction Learning and memory are similar traits across the Animal Kingdom, at the behavioural as well as the cellular level (Dubnau, 2003). The Nasonia genus is a good model to study memory for several reasons. Indeed, these insects reproduce rapidly and easily so … Read More»

Experiment to Treat Theileria in Cows

Theileria is a vector borne protozoan parasite that causes theileriosis which is a fatal disease for cows. It is a disease of tropics. Theileria poses a serious challenge to the exotic crossbred cattle population. T.annulata and T. parva are considered to be the most pathogenic species of theileria. Tropical theileriosis is one of the most prevalent diseases of cattle caused by T. annulata. … Read More»

Overview of Glycation Related Diseases

D) Glycation related diseases: Glycation is a deleterious form of post translational modifications of macromolecules and has been linked to a number of diseases. (Harding et al. 1989). Cardiovascular Diseases: The in vivo accumulation of AGE’s over time contributes to changes in function and structure of the cardiovascular system which results in formation of artificial … Read More»

The Interrelationship Between the Systems of the Human Body

This essay was produced by one of our professional writers as a learning aid to help you with your studies The Interrelationship Between the Systems of the Human Body Introduction This essay will consider the structure and function of the 11 systems within the human body. It will detail the interrelationship between the nervous system … Read More»

Fossil Record Evidence for Evolution

This essay was produced by one of our professional writers as a learning aid to help you with your studies The Fossil Records and Theories of Evolution. Introduction In general, the term ‘evolution’ can imply a drastic or gradual change from a very broad perspective. Life on earth, the universe,galaxies, as also the earth in … Read More»

Example 2:1 Biology Essay

This essay was produced by one of our professional writers as a learning aid to help you with your studies Example 2:1 Biology Essay NHS Cervical Screening Programme: Liquid Based Cytology vs. Conventional Cytology Introduction Cervical screening, such as the regular programme provided by the NHS, is a very successful way of detecting the early … Read More»



Most Used Categories

Testimonials
I order from this writer for quite a while, so we are having the chemistry going on between us. Great job as always!
Laura C., March 2018
Wow, ordering from EssayHub was one of the most pleasant experiences I have ever had. Not only was my work sent to me hours before the deadline, but the content was absolutely fantastic! Would order from them again!
Daniel L., March 2018
Professional Custom
Professional Custom Essay Writing Services
In need of qualified essay help online or professional assistance with your research paper?
Browsing the web for a reliable custom writing service to give you a hand with college assignment?
Out of time and require quick and moreover effective support with your term paper or dissertation?